Trichosporon oleaginosus Zhou et al. (ATCC® 20508)

Strain Designations: R  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Candida curvata
Strain Designations R
Application
Biodiesel production
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
alkali-tolerant at pH 10
Medium Medium 324: Malt extract agar
Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
Trichosporon oleaginosus ATCC 20508 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTGCTCTTTGAGCGTTAACTACATCCATCTACATCTGTGAACTGTTGATTGACTTCGGTCAATAACTTTTACAAACACTGTGTAATGAACGTCATGTTATTATAACAAAAATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTATCATGAAATCTCAACCATTAGGGTTTCTTAATGGCTTGGAATTGGGCGCTGCCACTTGCCTGGCTCGCCTTAAAAGAGTTAGCGTGTTAAACTTGTCGTAAACTGGCGTAATAAGTTTCGCTGGTGGTAGACTTGTGAAGGACGCTTCTAATCGTCTTCGGACACTTCTTGAACTCTGGTCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAAAGCTCAAATTTGTAATCTGGCTGTCTTCGATAGTCCGAGTTGTAATCTATAGACGTGTTTTCCGTGCTGGACCGTATCTAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGACAATCCCGTGCTTGATACGACCACCAGTGCTCTGTGATACACGTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTCTTCAGATTCAGCTGGTTCTTCCAGTCTACTTCTGTGGAACGGGTCAACATCAGTTTTGTCCGGTGGATAAAGGTAGTAGGAATGTGACTCCCCCGGGAGTGTTATAGCCTATTATTGCATACACTGGGTGAGACTGAGGACTGCAGCTCGCCTTTTGGCCGGTCTTCGGACACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGAC

Name of Depositor Iowa State Univ. Res. Fndn.
Chain of Custody
ATCC <-- Iowa State Univ. Res. Fndn. <-- NJ Moon
Isolation
dairy plant
References

Moon NJ, Hammond EG. Process for converting whey permeate to oil-containing yeast. US Patent 4,235,933 dated Nov 25 1980

Lognay G, et al. Sterol composition of Candida curvata yeast. Biotechnol. Lett. 9: 467-470, 1987.

Aono R. Taxonomic distribution of alkali-tolerant yeasts. Syst. Appl. Microbiol. 13: 394-397, 1990.

Gujjari P, et al. Characterization of oleaginous yeasts revealed two novel species: Trichosporon cacaoliposimilis sp. nov. and Trichosporon oleaginosus sp. nov. Mycologia. 103:1110-1118, 2011. PubMed: 21558504

Thiru M, Sankh S, Rangaswamy V. Process for biodiesel production from Cryptococcus curvatus. Bioresour. Technol. 102: 10436-10440, 2011. PubMed: 21930373

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation