Zygosaccharomyces florentinus Castelli ex Kudryavtsev, teleomorph (ATCC® 26812)

Strain Designations: 31  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Saccharomyces florentinus Castelli ex Kudryavtsev, teleomorph
Strain Designations 31
Application
production of palm wine
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Preceptrol® no
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24.0°C
Sequenced Data

    18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GATTTGAGGTCAACTTTAAGAACATTGTTCGCCTAGACGCTCTCTTCTTATCGATAACGTTCCAATACGCTCAGTATAAAAAAGATTAGCCGCAGTTGGTAAAACCTAAAACGACCGTACTTGCATTATACCTCAAGCACGCAGAGAAACCTCTCTTTGGAAAAAAAACATCCAATGAAAAGGCCAGCAATTTCAAGTTAACTCCAAAGAGTATCACTCACTACCAAACAGAATGTTTGAGAAGGAAATGACGCTCAAACAGGCATGCCCCCTGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTTAATATTTTAAAATTTCCAGTTACGAAAATTCTTGTTTTTGACAAAAATTTAATGAATAAATAAAATTGTTTGTGTTTGTTACCTCTGGGCCCCGATTGCTCGAATGCCCAAAGAAAAAGTTGCAAAGATATGAAAACTCCACAGTGTGTTGTATTGAAACGGTTTTAATTGTCCTATAACAAAAGCACAGAAATCTCTCACCGTTTGGAATAGCAAGAAAGAAACTTACAAGCCTAGCAAGACCGCGCACTTAAGCGCAGGCCCGGCTGGACTCTCCATCTCTTGTCTTCTTGCCCAGTAAAAGCTCTCATGCTCTTGCCAAAACAAAAAAA

Sequence id as Saccharomyces cerevisiae .

Name of Depositor N Okafor
Isolation
Elaeis palm wine, Nigeria
References

Okafor N. Palm-wine yeasts from parts of Nigeria. J. Sci. Food Agric. 23: 1399-1407, 1972.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation