Zygosaccharomyces bailii (Lindner) Guilliermond, teleomorph (ATCC® 42476)

Strain Designations: 922  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Saccharomyces bailii var. bailii Lindner, teleomorph
Strain Designations 922
Application
Production of sherry type wine
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Preceptrol® no
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TTTCCGTAGGTGAACCTGCGGAAGGATCATTATAGAAAATTTCTGATTGACGAGTCTGGAGTAGTTGTGTTCTCTCTGTTTTTTCAAGGCCTGCGCTTAATTGCGCGGTCTAGAGCGGAGGGAGTTAAACATAGTTACTCTGGCTTTCAATTTACACACAGTGGAGTTTCTACTTTTTTTATTCTTCTTTGGGAGGATGGGTTCGTCCCACTCCCAGAGGTAAAAACACAAACAATTTTTTTTTTTTTTTTTAATATTACACAGTCAAAAACGAATACTAAAAAACAAAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCGTGTTTGGTAGTGAGTGATACTCTGTTTTTCATTTGGGTTAACTTGAAATTGCAAGCCTTTTGGGGAACGCGTGTGGGTGAGTTTTAGGCGGAAACGTCTTGCTCTCCTCTTTCCTAACCAAATGTCGTATTAGGTTTTACCGACTCCGACAGACGGGACTAGGAGATTGGGTGAGTGATAGCAATATCGAGCTCTGCCTAATTTTTTTTTTGCGCGCCTTGGGCAAACAATACTCTCAAAGTTTGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGTAGAAGGCGACTCTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGAAGTCATGGAGGGTGAGAATCCCGTATGGCGAGGATCCCAGTTCTTTGTAGAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCTCGCCTCTCGTGGGTGGGGGAATCTCGCAGTTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCCCTGGGAATGTAGCTCTACCACTTCGTGGCGGACGAACTTATAGTCCAGGGGAATACTGCCAGCTGGGACTGAGGAATGCGACTTTTAGTCAAGGATGCTGGCATAATGGTTATATGCCGC

Name of Depositor GA Farris
Cross References

Nucleotide (GenBank) : JX458102 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX458121 D1/D2 region of 26S rRNA gene

Nucleotide (GenBank) : KC678098 RNA polymerase II largest subunit (RPB1) gene

Nucleotide (GenBank) : KC678070 polymerase II second largest subunit (RPB2) gene

References

Ann. Microbiol. 26:55, 1976.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation