Aspergillus fijiensis Varga et al. (ATCC® 20611)

Strain Designations: ACE-2-1  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Aspergillus niger van Tieghem, anamorph
Strain Designations ACE-2-1
Application
produces inulosucrase fructosyl transferase
produces pyridoxine derivatives
produces a fructooligosaccharide-producing beta-fructofuranosidase
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACCGAGTGCTGGGTCCTTCGGGGCCCAACCTCCCACCCGTGCTTACCGTACCCTGTTGCTTCGGCGGGCCCGCCTTCGGGCGGCCCGGGGCCTGCCCCCGGGACCGCGCCCGCCGGAGACCCCAATGGAACACTGTCTGAAAGCGTGCAGTCTGAGTCGATTGATACCAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTCCCCTCCAGCCCCGCTGGTTGTTGGGCCGCGCCCCCCCGGGGGCGGGCCTCGAGAGAAACGGCGGCACCGTCCGGTCCTCGAGCGTATGGGGCTCTGTCACCCGCTCTATGGGCCCGGCCGGGGCTTGCCTCGACCCCCAATCTTCTCAGATTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTCCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTTGGGTGCGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGGTGTCCGTGCCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCTCGGGGTTCAGCCGGCACTCGTGCCGGTGTACTTCCCCGGGGGCGGGCCAGCGTCAGCTTGGGCGGCCGGTCAAAGGCCTCCGGAATGTAGTGCCCCCCGGGGCACCTTATAGCCGGAGGTGCAATGCGGCCAGCCTGGGCTGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGCAAAC


Calmodulin

GAGGCCTTCTCCCTTTTTGTAAGCGACCCCGATGCTTTCTCGTCTGCTATAAAACAATGTTTACTGATTCGTTTCTCGTGATCCCTGATAGGACAAGGATGGCGATGGTTAGTGTAGTTCTTTACCCCTCAACGAAACCCGCCTGGCATCACCTGGCACTATAGCCACCATACCGCAAACGCCACAGAAACTATCAAGAATCGATCGCATTTCTGACAGAATCCATGCTACAGGACAAATTACCACCAAGGAGTTGGGTACCGTTATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCTGAGCTCCAGGACATGATCAACGAGGTTGACGCTGACAACAACGGCACTATCGACTTTCCCGGTATGTGATGGCCATGCATCGAGCTCCGGACATAGTATTGACAGCTGCCCAGAATTCCTTACCATGATGGC

Name of Depositor Meiji Seika Kaisha, Ltd.
References

Suzuki Y, Uchida K. Formation of beta-fructosyl compounds of pyridoxine in growing culture of Aspergillus niger. Biosci. Biotechnol. Biochem. 57: 875-880, 1993. PubMed: 7763873

Kono T, et al. Fructose transferring enzyme absorbed on a granular carrier for production of fructooligosaccharides. US Patent 5,314,810 dated May 24 1994

Adachi T, Hidaka H. Sweetener. US Patent 4,681,771 dated Jul 21 1987

Hidaka H, et al. A fructooligosaccharide-producing enzyme from Aspergillus niger ATCC 20611. Agric. Biol. Chem. 52: 1181-1187, 1988.

Hirayama M, et al. Purification and properties of a fructooligosaccharide-producing beta-fructofuranosidase from Aspergillus niger ATCC 20611. Agric. Biol. Chem. 53: 667-673, 1989.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation