Candida viswanathii Sandhu et Randhawa (ATCC® 20962)

Strain Designations: H5343  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Candida tropicalis (Castellani) Berkhout
Strain Designations H5343
Application
Produces dicarboxylic acids
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Genotype pox5:ura3A pox5:ura3A pox4A:ura3A pox4B:URA3A
Preceptrol® no
Comments
Cannot utilize dodecane or methyl laurate as sole carbon source for growth.
Morphology On YM medium at 25°C after 3 days, colonies creamy white to dingy white, raised, dull, margin entire becoming filamentous with age. Cells subglobose to broadly ellipsoidal, smooth, guttulate, small cells 6.8-8.3 X 3.8-6.0 µm, large cells 13.5-15.0 X 6.8 µm. Pseudohyphae present.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence:

GGGGGGACTCGTTTCCGCCGCCAGAGGTCACAACTAAACCAAACTTTTTATTACCAGTCAACCATACGTTTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAGCCCGCGGGTTTGGTGTTGAGCAATACGCCAGGTTTGTTTGAAAGACGTACGTGGAGACTATATTAGCGACTTAGGTTCTACCAAAACGCTTGTGCAGTCGGCCCACCACAGCTTTTCTAACTTTTGACCTC


D1D2 region of the 26S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCAGGTCCGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGCATTTTGCATGTTGCTTCTTCGGGGGCGGCCTCTGCGGTTTGTCGGGCCAGCATCAGTTTGGGCGG

Morphology On YM medium at 25°C after 3 days, colonies creamy white to dingy white, raised, dull, margin entire becoming filamentous with age. Cells subglobose to broadly ellipsoidal, smooth, guttulate, small cells 6.8-8.3 X 3.8-6.0 µm, large cells 13.5-15.0 X 6.8 µm. Pseudohyphae present.
Name of Depositor Henkel Research Corp.
U.S. Patent Number
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished.
Special Collection NCRR Contract
Isolation
Derived from ATCC® 20913™
References

Picataggio S, et al. Site-specific modification of the Candida tropicalis genome. US Patent 5,254,466 dated Oct 19 1993

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation