Scytalidium dimidiatum (Penzig) Sutton et Dyko, anamorph (ATCC® 26226)

Strain Designations: 328/8/70  /  Product Format: freeze-dried

Deposited As Hendersonula toruloidea Nattrass, anamorph
Strain Designations 328/8/70
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology On PDA medium at 25°C after 7 days, mycelium white to grayish white, cottony, dense. Reverse creamy white. Hyphae hyaline to dark brown, guttulate. Conidia hyaline to dark reddish brown, ovoid to broadly ellipsoid, smooth, 9 X 5.5-6 µm. Arthroconidia doliiform to cylindrical, dark reddish brown, smooth, 12-13.5 X 3-7.5 µm.
Medium Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACCGAGTTGATTCGGGCTCCGGCCCGATCCTCCCACCCTTTGTGTACCCACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCGGCCGCCCTCCGTCCGGGGGGTGGCCAGCGCCCGCCAGAGGACCATCGAACTCCGGTCAGTGAACGTTGCCGTCTGAAAAACAATCAATAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAAGCTCTGCTTGGTGTTGGGCACCGCCCTTCCGCGGGCGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCGAGCGTAGTAGAAAACACCTCGCTTTGGAGCGCACGGCGCCGCCCGCCGGACGAACCTTTTGAACTTTCTCAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCCCCCGGGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCCATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGCACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCCCGGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCGGCTAGGATGCTGGCGTAATGGCTGTAAGCGG

Morphology On PDA medium at 25°C after 7 days, mycelium white to grayish white, cottony, dense. Reverse creamy white. Hyphae hyaline to dark brown, guttulate. Conidia hyaline to dark reddish brown, ovoid to broadly ellipsoid, smooth, 9 X 5.5-6 µm. Arthroconidia doliiform to cylindrical, dark reddish brown, smooth, 12-13.5 X 3-7.5 µm.
Name of Depositor FM Rush-Munro
Isolation
Onychomycosis, New Zealand