Cryptococcus gattii (Vanbreus. et Takashio) Kwon-Chung et Boekhout, anamorph (ATCC® MYA-4560)

Alternate State: Filobasidiella bacillispora Kwon-Chung, teleomorph  /  Strain Designations: WM179 [CBS 10078]  /  Product Format: frozen

Strain Designations WM179 [CBS 10078]
Alternate State Filobasidiella bacillispora Kwon-Chung, teleomorph
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Antigenic Properties Serotype B
Genotype VGI, AFLP4
Preceptrol® no
Mating Type MATalpha
Comments
Reference strain of VG I, AFLP4 molecular type of C. gattii.
Sequenced Data
ITS of MYA-4560:

TTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATGCTGGGCTTCGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCTTATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAAT


D1D2 region of the 28S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCCGGGCGTCCGAGTTGTAATCTACAGAAACGTTTTCCGTGCTGGACCGTGTCTAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGATCACCAGTGCTCTGTGATACGTTTTCTACGAGTCGCGTTACTTGGGAGTGTAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGTGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGGTTCAGCCAGCTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGGATAAGGGCTGGAGGAATGTGGCACTCTTCGGGGTGTGTTATAGCCTCCTGTCGCATACACTGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACAAAATGGCTTTAAACGA

Name of Depositor KJ Kwon-Chung
Special Collection ATCC
Chain of Custody
ATCC <-- KJ Kwon-Chung <-- W Meyer <-- S Chen
Isolation
Human, Australia
Cross References

Nucleotide (GenBank) : FJ914887 ITS including 5.8S rRNA gene

References

Meyer W, et al. Molecular Typing of IberoAmerican Cryptococcus neoformans Isolates. Emerg. Infect. Dis. 9: 189-195, 2003.

Meyer W. et al. Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii. Med. Mycol. 47(6):561-570, 2009. PubMed: 19462334