Allomyces macrogynus (Emerson) Emerson et Wilson (ATCC® 38327_TT)

Strain Designations: Burma 3-35  /  Product Format: test tube

Permits and Restrictions

View Permits

Strain Designations Burma 3-35
Application
classroom demonstration
Biosafety Level 1
Product Format test tube
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Motility
Male gamete messenger RNA
Autotetraploid
Genome sequencing strain (Broad Institute, USA).
Morphology

After 2 weeks advancing zone appressed, mycelium white with older growth turning butyrous and orange as zoosporangia are formed.

Medium Medium 350: Emerson YpSs agar
Growth Conditions
Temperature: 24.0°C
Sequenced Data
GenBank accession number: JX094785

Large subunit ribosomal RNA gene, partial sequence.

CGAGTAATGGCGAATGAAACGGGAAAAGCCCAAATTTGAAATCTCCTAGCTTTTATCGCTAGGCGAGTTGTAATTTGTAGAAGGTCTTCATCTGAACTGTGTTTGCTAAAGTCCATTGGAAAATGGCGGGCCTTTATGGTCCTCAAGTCGTAGAGGGTGACAACCCCGTTCTTGGCATTCTACTAGTTCTTTTGTATGATTCCTTCAAAGAGTCGGATTGTTTGGGAATGCAATCCAAAACGGGTGGTAAATTCCATCCAAGGCTAAATATTAGCAAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTCTGAAGAGAGAGTTCAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAACGATTGTTGCTTTTGGTTTCGGCCTTGAGCGAGTCAGCAGCAGTTTTAAACGGTAAAGAAGTGCTTGTGGAAGGTAGTTTTCTTTGGAAAATGTTATAGCCATAAGTAACTGTGCCGGTTAGGACTGAGGATCGCTTTTAAGTGTCTTGTCGAGGAATTTTGGGCCGTTAGCGCCAAGGCCTTGGGCTTGCTCAAGACTTGGTGTTAACTGTTCAGGACGACCAAACACAAGGCCTTAAAAT

Morphology

After 2 weeks advancing zone appressed, mycelium white with older growth turning butyrous and orange as zoosporangia are formed.

Name of Depositor J Pommerville
Chain of Custody
ATCC <<--J Pommerville<<--R. Emerson
Isolation
pond soil
Cross References

Complete Genome (GenBank) : ACDU00000000 Allomyces macrogynus ATCC 38327, whole genome shotgun sequencing project

References

Morrison PJAllomyces macrogynusIn: Morrison PJLower fungi in the laboratoryAthens, GAUniv. Georgiapp. 45-46, 1978

Eisenberg A, Mascarenhas JP. Male gamete messenger RNAs in Allomyces. Exp. Mycol. 5: 173-177, 1981.

Pommerville J. Analysis of gamete and zygote motility in Allomyces. Exp. Cell Res. 113: 161-172, 1978. PubMed: 565293

. . Protoplasma 100: 323-343, 1979.

Aronson JM, Sandstedt V. Allomyces macrogynusIn: Aronson JM, Sandstedt V. Lower fungi in the laboratory. Athens, GA Univ. Georgia. pp. 51-52, 1978.

Barstow WE. Allomyces macrogynusIn: Barstow WE. Lower fungi in the laboratory, Athens, GA Univ. Georgia. pp. 49-50, 1978.

Pommerville J. Allomyces macrogynus--gametes and fertilizationIn: Pommerville J. Lower fungi in the laboratory. Athens, GA Univ. Georgia. pp. 47-48, 1978.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation