Acremonium alcalophilum Okada, anamorph (ATCC® 90507)

Strain Designations: JCM 7366 [CBS 114.92, IMI 351927, PA-2M]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations JCM 7366 [CBS 114.92, IMI 351927, PA-2M]
Biosafety Level 1
Product Format frozen
Type Strain yes RefOkada G, et al. Acremonium alcalophilium, a new alkalophilic celluloytic hyphomycete. Trans. Mycol. Soc. Jpn. 34: 171-185, 1993.
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute (JGI) at the Department of Energy, USA).
Medium Medium 2758: Oatmeal Agar w/ 2N KOH
Growth Conditions
Temperature: 25°C
pH: requires high pH for growth (alkaliphilic)
Sequenced Data
       18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TGCGGAGGGATCATTACAGAGTGTTTTTCCAACCTCATAACCCTATGTGAACCTATATACCACGTTGCTTCGGCGGCGCGTCCCCCCGGGGTCGTGCCCGCCGGCGTTAACCAGTCTCTCAGTCATGAACCGACGTTACTTCTGAGTGTTCTAAGCGAACTGTTAAAACTTTCAACAACGGATCTCTTGGCTCCAGCATCGATGAAGAACGCAGCGAAACGCGATATGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTCCCAGTATCCTGGGAGGCATGCCTGTCCGAGCGTCGTTTCAACCCTCGAGCCCCCGTGGCCCGGTGTTGGGGAACCGCGAGCGAGAGCTCCCGCGGTCCCCGAAATGCAGTGGCGGTCCCGCAGCGTCCCGGCCCTTTGCGTAGTAATTATCGCTCGCATTGGCAGGCCCGCGGGTTACCAGCCTTGAAACCCCCTACAAAGACCGCTCCGGCGGCACGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCATA

Name of Depositor JCM
Chain of Custody
ATCC <<--JCM<<--G. Okada PA-2M
Isolation
sludge of pig manure compost, Kanagawa, Japan
References

Okada G, et al. Acremonium alcalophilium, a new alkalophilic celluloytic hyphomycete. Trans. Mycol. Soc. Jpn. 34: 171-185, 1993.

type strain

Okada G, et al. Acremonium alcalophilium, a new alkalophilic celluloytic hyphomycete. Trans. Mycol. Soc. Jpn. 34: 171-185, 1993.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation