Agaricus bisporus (Lange) Imbach var. bisporus, teleomorph (ATCC® MYA-4626)

Strain Designations: FGSC 10389 [H97]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations FGSC 10389 [H97]
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type A1
Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Medium Medium 336: Potato dextrose agar (PDA)
Medium 324: Malt extract agar
Growth Conditions
Temperature: 20.0-25.0°C
Sequenced Data
>ITS of MYA-4626

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTATGTTTTCTAGATGGGTTGTAGCTGGCTCTTCGGAGTATGTGCACGCCTGTCTGGACTTCATTTTCATCCACCTGTGCACCTTTTGTAGTCTTTTTCAGGTATTGGAGGAAGTGGTCAGCCTATCAGCTCTTTGCTGGATGTAAGGACTTGCAGTGTGAAAACAGTGCTGTCCTTTACCTTGGCCATGGAATCTTTTTCCTGTTAGAGTCTATGTTATTCATTATACTCTTAGAATGTCATTGAATGTCTTTACATGGGCTATGCCTATGAAAATTATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTATATTCTCAACTCTCCAATACTTTGTTGTAAAGGAGAGCTTGGATTGTGGAGGTTTGCTGGCTCCTTACTTGGGGTCAGCTCCTCTGAAATGCATTAGCGGAATCGTCTGCGATCTGCCACAAGTGTGATAACTTATCTACACTGGCGAGGGGATTGCTTTCTGATGTTCAGCTTCTAATCGTCTAAGGACAATTTCTTGAATGCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA

//

Name of Depositor FGSC
Special Collection ATCC
Chain of Custody
ATCC <-- FGSC
Cross References

Nucleotide (GenBank) : GU327642 ITS including 5.8S rRNA gene

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation