Aspergillus carbonarius (Bainier) Thom, anamorph (ATCC® MYA-4641)

Strain Designations: A1102 [ITEM 5010, IMI 388653]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations A1102 [ITEM 5010, IMI 388653]
Application
Ochratoxin A producer
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Sequenced Data
ITS DNA sequence of MYA-4641

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCACCCGTGTCTATTGTACCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCATCTCTGCCCCTCGGGCCCGTGCCCGCCGGAGACACCAACACGAACACTGTCTGAAATCGTGAAGTCTGAGTCGATTGTTTTCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTGTCTGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACAACTCCAACCTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAA


D1D2 DNA sequence of MYA-4641

ACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGAGTCCGCATTGTAATTTGCAGAGGATGCTTTGGGTGCGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGGTGTCCGTGCCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCTGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCAGGGGTGCAATGCGGCCAGCCTAGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTTGTAAACGACCCGTCTT

Name of Depositor G Perrone
Special Collection ATCC
Chain of Custody
ATCC <-- G Perrone
Isolation
Grape berry, Brindis, Apulia, Italy.
Cross References

Nucleotide (GenBank) : GU291292 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : GU291282 ITS including 5.8S rRNA gene

References

Perrone G, et al. AFLP characterization of southern Europe population of Aspergillus Section Nigri from grapes. Int. J. Food Microbiol. 111: S22-S27, 2006.

Perrone G, et al. Ochratoxin A production and amplified fragment length polymorphism analysis of Aspergillus carbonarius, Aspergillus tubingensis, and Aspergillus niger strains isolated from grapes in Italy. Appl. Environ. Microbiol. 72: 680-685, 2006.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation