Alternaria alternata (Fries) Keissler (ATCC® 6663)

Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Alternaria tenuis Nees
Application
produces ALT-I
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Comments
Allergenic fraction (ALT-I)
Medium ATCC® Medium 343: V8 juice agar
ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 340: Rabbit food agar
Growth Conditions
Temperature: 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AGGGATCATTACACAAATATGAAGGCGGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGG

Name of Depositor JE Machacek
Chain of Custody
ATCC <-- JE Machacek <-- CBS
References

Yunginger JW, et al. Studies on Alternaria allergens. III. Isolation of a major allergenic fraction (ALT-1). J Allergy Clin Immunol 66: 138-147, 1980. PubMed: 7190582

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation