Trichophyton interdigitale (ATCC® MYA-4439)

Strain Designations: MRL 1957  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations MRL 1957
Application
Susceptibility testing
Antifungal susceptibility testing RefGhannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006. RefEspinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments The most common cause of athlete's foot
Keratinophilic dermatophyte

The strain was re-identified as Trichophyton interdigitale in the Trichophyton mentagrophytes species complex based on the multigene sequence analysis.
Morphology After 10 days on Emmons' medium colonies powdery to floccose, cream-coloured to yellowish-buff; reverse ochre to red-brown. Macroconidia sparse, 3-8-celled, clavate to cigar-shaped. Microconidia spherical, sessile, arranged in dense, grape-like clusters or alongside the hyphae.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGCGCGCAGGCCGGAGGCTGGCCCCCCACGATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACATTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGTTCGGCGAGCCTCTCTTTAGTGGCTAAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTTTGGGGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTCAAAATCTGTTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCCCGGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGCGGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGCGGGGTTCAGCGGGTGCTCGTCGCCCGTGTATTCCTCGTCTCCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGGGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGGC


beta-tubulin (TUB2) gene

CTAGCTTTCCCCCTGTCCATCACTTCCCCTCTATTTGTGCCCGAAAAACACGACACGGTCTGCACAGGCCAAGAAAGGGGGGGAGGCGAGGGCCACCACACGACCACGTCCCAGCGTGAAGGGGACAGGCTTCGAGTTTCACAATTCTCGCATAGCGAGCTTCGAGCATCAGGCTAACGTGCATTTATCGTATAGGTCCATCTCCAAACCGGCCAATGTGTAAGCTTTGATCGTTCCCTGGTTCGTTCTCAGGTACCCGTTTGAGTTAACAATTGTTCGACATTAGGGTAACCAAATTGGTGCTGCTTTCTGGTGAGCATTCATGCGTTGCAGCATAATTGTATATTTCGTGTCGAGTTGTTACTGACTTGGTTTACAGGCAAACCATTGCTGGTGAGCACGGTCTCGATGGATCCGGCCAGTGAGTGATTCTGCAAGAAAAAGTTCCGGTCTTGAGGGACTTGAACGTTGACAACTGGGATTTCTATAGCTACACCGGATCTTCTGACCTCCAATTGGAGCGCATGAATGTCTACTTCAACGAGGTGTGCACGACCAAGACCCTTCCCTTCAGCAGCATACTAACTCATTGGAGGCAAAGGCCTCAAGCAAAAAATACGTTCCCCGTGCGGTTCTTGTTGATCTTGAGCCCGCCGCTCTCGATGCTGTCCGCGCCGGTCCTTTTGGTCAGCTCTTCCGCCCCGATAACGTCGTCTTCGGTCAGTCTGGTGCCGGAAACAACTGG

Morphology After 10 days on Emmons' medium colonies powdery to floccose, cream-coloured to yellowish-buff; reverse ochre to red-brown. Macroconidia sparse, 3-8-celled, clavate to cigar-shaped. Microconidia spherical, sessile, arranged in dense, grape-like clusters or alongside the hyphae.
Name of Depositor MA Ghannoum
Special Collection ATCC
Chain of Custody
ATCC <-- Ghannoum
Isolation
human toenail, USA
Cross References

Nucleotide (GenBank) : KJ606113 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KJ606161 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KJ606209 beta-tubulin (TUB2) gene

Nucleotide (GenBank) : FJ746658 ITS including 5.8S rRNA gene

References

Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi; Approved Standard. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M38-A.

Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi: Approved Standard - 2nd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M38-A2.

Ghannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006.

Shehata AS, et al. Comparison between the standardized Clinical and Laboratory Standards Institute M38-A2 method and a 2,3-bis(2-methoxy-4-nitro-5-[(sulphenylamino)carbonyl]-2H-tetrazolium hydroxide- based method for testing antifungal susceptibility of dermatophytes. J. Clin. Microbiol. 46: 3668-3671, 2008.

Espinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Other Documentation