Aspergillus fumigatus Fresenius, anamorph (ATCC® 90906)

Strain Designations: 151  /  Product Format: freeze-dried

Strain Designations 151
Application
Biomedical Research and Development Material
Emerging infectious disease research
Opportunistic pathogen research
Respiratory research
Biosafety Level 2
Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
In vitro sensitivity to itraconazole, fluconazole and amphotericin B
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 312: Czapek's agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCCTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

Name of Depositor H Dermoumi
Special Collection NCRR Contract
Isolation
human blood, Essen, Germany
Cross References

Nucleotide (GenBank) : KC689327 ITS including 5.8S rRNA gene

References

Dermoumi H. In vitro susceptibility of fungal isolates of clinically important specimens to itraconazole, fluconazole and amphotericin B. Chemotherapy 40: 92-98, 1994. PubMed: 8131639