Candida albicans (Robin) Berkhout, anamorph (ATCC® 28121)

Strain Designations: 304  /  Product Format: freeze-dried

Strain Designations 304
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Effect in guinea pig leucocytes
Morphology Colonies are white to cream-colored, butyrous to membranous, entire to erose margins. Cells globose-ovoid-ellipsoid, reproducing by budding. Pseudohyphae present.
Medium Medium 200: YM agar or YM broth
Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene:

AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTTGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCTTGAAA

Morphology Colonies are white to cream-colored, butyrous to membranous, entire to erose margins. Cells globose-ovoid-ellipsoid, reproducing by budding. Pseudohyphae present.
Name of Depositor DH Howard
Isolation
feces, California
References

Howard DH. Fate of Histoplasma capsulatum in guinea pig polymorphonuclear leukocytes. Infect. Immun. 8: 412-419, 1973. PubMed: 4125783