Candida albicans (Robin) Berkhout, anamorph (ATCC® 76485)

Strain Designations: Unknown  /  Product Format: freeze-dried

Strain Designations Unknown
Application
Use in rabbit model of central nervous system infection
Opportunistic pathogen research
Sexually Transmitted Disease Research
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Use in rabbit model of central nervous system infection
Morphology After 3 days on YM agar at 25°C colonies are cream-colored, dull, often becoming wrinkled with a mycelial border on prolonged incubation. Yeast cells globose to short-ovoid, hyaline, 2-7 x 3-8.5 µm, single or budding, occasionally forming short chains.
Medium Medium 200: YM agar or YM broth
Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCTACCACGTATATCTTCAAACTTtGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG


Large subunit ribosomal RNA gene, partial sequence.

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTYTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTAACCTAGGATGTTGGCATAATGATCTTAAGTCGC

Morphology After 3 days on YM agar at 25°C colonies are cream-colored, dull, often becoming wrinkled with a mycelial border on prolonged incubation. Yeast cells globose to short-ovoid, hyaline, 2-7 x 3-8.5 µm, single or budding, occasionally forming short chains.
Name of Depositor GH McCracken
Chain of Custody
ATCC <-- GH McCracken <--Childrens Medical Ctr., Dallas, TX
Isolation
cerebrospinal fluid of a 6-month-old infant, Dallas, TX
Cross References

Nucleotide (GenBank) : JX094780 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX094790 Large ribosomal subunit

References

Jafari HS, et al. Characteristics of experimental Candida albicans infection of the central nervous system in rabbits. J. Infect. Dis. 164: 389-395, 1991. PubMed: 1856486