Aspergillus amstelodami (Mangin) Thom et Church, anamorph (ATCC® 1001)

Alternate State: Eurotium amstelodami Mangin, teleomorph  /  Strain Designations: 4013 [NRRL 92]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations 4013 [NRRL 92]
Alternate State Eurotium amstelodami Mangin, teleomorph
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain no
Intended Use
Preceptrol® no
Morphology After 7 days on Blakeslee’s malt extract medium at 25°C, colonies are flat, powdery dark green or yellow; reverse uncolored. Cleistothecia globose, yellow. Asci hyaline, with 8 ascospores. Ascospores hyaline, lenticular, with longitudinal flange. Conidial heads radiate, vesicles pyriform, uniseriate. Conidia globose, rough-walled.
Medium ATCC® Medium 325: Malt extract agar (Blakeslee's formula)
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
Partial caM gene for calmodulin

TCTTCGTAAGTGCGCTGGCCATCTCCATGTGGCATTTTCCCCGTCGAACGTCGAGGACAGTGAACTGACCATGATTTTTGCATTTCTACAGGACAAGGATGGCGATGGTTAGTGATCCCGCTCTACTCTATATTCAATGTCTCTTTTACCCCACCATTCGATTGGCTCCGACCGTGATATCATATTCGCTGTTGAAATAATGCTCTTCCGTTACGACATGATACTGATGTATCTTCGCGACTACAGGCCAGATCACCACCAAGGAGCTGGGTACCGTTATGCGCTCGCTGGGCCAGAACCCTTCCGAGTCGGAGTTGCAGGACATGATCAATGAGGTTGACGCTGACAACAACGGCACCATCGATTTCCCTGGTATGCGATCGTCCCGACATAAAACGTTCTGTAACATGATAGGCGATTCTGACCCAAATAGAATTCCTTACCAT

Morphology After 7 days on Blakeslee’s malt extract medium at 25°C, colonies are flat, powdery dark green or yellow; reverse uncolored. Cleistothecia globose, yellow. Asci hyaline, with 8 ascospores. Ascospores hyaline, lenticular, with longitudinal flange. Conidial heads radiate, vesicles pyriform, uniseriate. Conidia globose, rough-walled.
Name of Depositor C Thom
Chain of Custody
ATCC <-- C Thom <-- Brewster
Isolation Moldy ham
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation