Zygosaccharomyces siamensis Saksinchai et al. (ATCC® 12572)

Strain Designations: P3a [BI CZAS 322, CCY 35-9-1]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Saccharomyces mellis (Fabian et Wuinet) Lodder et Kreger-van Rij, teleomorph
Strain Designations P3a [BI CZAS 322, CCY 35-9-1]
Application
produces ethyl alcohol ethanol
produces polyols
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Preceptrol® no
Morphology After 3 days at 25°C on YM agar, the cells are spherical to ovoid, 2-8 x 2-10 µm, and occur singly, in pairs or in small clusters.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GAGAATGAAAAAAAGTTCGAAGAGCAGGATGAAGCAAGAGGGGGGAGTGAGGAAAACGAGGTAGAGAGAGGGTGATTTGGGGGACCTGCGCTTAATTGCGCGGCTCCTGGGTCGCTTGTTTTTCTGCCTGGTATGCGTTGCCCTTGTGTGATGCGCTTTGCTCTCTTTTTTTCTTTGTCCGCCTTTGATTACACACGGTGGAGTTTCTGCTTTTATTGATGGCTTTGGGGGGCCTGAAGAGGGTTGGTTAGTCTTTCCCTCTCGTCCCCCAGAGGTAAACACAAACAAGATTTTTATGATACACAGCCAGTCAAAACAGAATTCGAGAAACGAATTTAGCAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAACTGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCCTCTCAAACGCTTGCGTTTGGTAGTGAGCGATACTCTATCTGACCTGACCCCCCCGACCTGGGCGACTGGGGAGAGGGGAGCAGGAAGTGGAGTTTGCTTGAAAGTGGGAGGCCATAGACGGAGCTTAGCTTGAGTGCGCAGTTGAAGCTGTGACGCCTGGCCGCGAAAACGAAGTCGTATTAGGTTTTACCGACTCGGCGAAGGAAGTAGTGGACGGGGGGAAAAGAGCAGAGCTTTTTTGCTTGCTGGCTTGACAGAATTCTCAAAGTTTGACCTCAAATCAGGTAGGA


26S ribosomal RNA gene, partial sequence

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGTACCATTCGGTGCCCGAGTTGTAATTTGGAGAGAGCGATTCTGGGGCTGGCGCTTGCCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTGAGGCGAGATGTACCAGTTCTTTGTAGAGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGAGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGGACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCCTCGCTCCTCGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGTGGCAGGAGAAAGCCTCGGGAATGTGACTCTTGCCTTTTTGGCGGGGGTGTTATAGCCCGAGGGGAATACTGCCAGCCGGGACTGAGGTATGCGACTCTCGTAGTCAAGGATGTTGGCATAATGGTTATATGCCGC

Morphology After 3 days at 25°C on YM agar, the cells are spherical to ovoid, 2-8 x 2-10 µm, and occur singly, in pairs or in small clusters.
Name of Depositor JF Spencer
References

Groleau D, et al. Production of polyols and ethanol by the osmophilic yeast Zygosaccharomyces rouxii. Biotechnol. Lett. 17: 315-320, 1995.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation