Candida metapsilosis Tavanti et al. (ATCC® 14054)

Strain Designations: 3175  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Candida parapsilosis (Ashford) Langeron et Talice, anamorph
Strain Designations 3175
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Preceptrol® no
Morphology After 4 day at 25°C colonies cream-coloured, semi-dull to glistening and smooth. Yeast cells globose to oval 2,0-3,5 x 3,0-4,5 µm, single or budding. Long, elongated cells sometimes produced, pseudomycelium produced forming very straight, regular chains of elongated cells after 2-3 days.
Medium Medium 200: YM agar or YM broth
Medium 1245: YEPD
Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
>D1/D2 region of 26S rRNA gene
TTCCACTCATTGGTACAAACTCCAAACATTCTTCCAAATTCGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCAGACCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTCTTTCGGGGGTGGCCTCTACAGTTTACCGGGCCAGCATCAGTTTGGGCGGTAGGAGAATTGCAAAGAAATGTGGCACTGCTTCGGTAGTGTGTTATAGTCTTTGTCGATACTGCCAGCCTAGACTGAGGACTGCGGCTTCGGCCTAGGATGTTGGCATAATGATCTTAAGTCGC
Morphology After 4 day at 25°C colonies cream-coloured, semi-dull to glistening and smooth. Yeast cells globose to oval 2,0-3,5 x 3,0-4,5 µm, single or budding. Long, elongated cells sometimes produced, pseudomycelium produced forming very straight, regular chains of elongated cells after 2-3 days.
Name of Depositor CW Emmons
Chain of Custody
ATCC <-- CW Emmons <-- J Blair
Isolation
Human, New York, USA
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation