Piriformospora indica Verma et al. (ATCC® 204458)

Strain Designations: END1 [DSM 11827]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations END1 [DSM 11827]
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Genome sequencing strain (Institute of Bioinformatics and Systems Biology, Helmholtz Zentrum München, Neuherberg, Germany)
A biotrophic symbiont that colonizes the root cortex cells of a broad range of plant species
Morphology On PDA medium at 30°C after 10 days, mycelium creamy white to buff, velutionous, forming zonations of texture. Reverese creamy white to buff. Hyphae hyaline. Chlamydospores abundant, hyaline, light-bulb to pear shaped, guttulate, 16-21 X 14.5-18 µm.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAACGAATTTCGATTCGGTCTTCTGTGCTGGTGGCAACACATGTGCACGTCGATCGTAATTCCATCCTCCTTTCAATTGTCCAAGTGCGTTCGGTCGGCCTCTGGGTCGAAGAAGCGTGGCTGCCAGGCTCGTTTCGTTCTGAATGCACATTGGTTATTTCACCCACTCTGGGTACTAGAAACAAAGAAATATTCATATAAACTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACGCCCGTTTGAGTGTCGTTGTACTCTCAATCCTACAATTTTTGTTGTACGGATTGGACTTGGGTCCTGTTGCGCTCTGCAACTGATCCGAAATGTATCAGCGTGTGTCCGTCGTGACGATGAACCGATTGTTAAGTTTCATCGGGCTCGCTTTGTCGAGGTCGTCTGACGAAATGCATGCCTAACCCTCCTATACTTTGACAATTCGACCTCAAATCGGGTGGGATCACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCTCAAATTTTGAATCTGGCGCCTTTGGCTCCCGAGTTGTAATCTAGAGAAGTGTCTTCCGCATCGGACCGTGTACAAGTTCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTACATGCCACGGACTACCTTTGCTCTGTGATACACTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGGAGTCAGTCGCGTCTGGCGGGATTCAGCCTTGCTTCTGCTTGGTGTATTTCCTGTCCGACGGGTCAGTGTCGATTTCGACTGAGGGAAAAAGGCTTGGGGAATGTGGCCATCTTCGGGTGGTGTTATAGCCCCTTGTTGTATGTCTCAGTTGGGATCGAGGTCAGCAGCGCGCCTTTTGGCCGGGGTTCGCGCCCTCGGTACGCGCTTAGGACACTGGCATAATGGCTTTAAGCGA

Morphology On PDA medium at 30°C after 10 days, mycelium creamy white to buff, velutionous, forming zonations of texture. Reverese creamy white to buff. Hyphae hyaline. Chlamydospores abundant, hyaline, light-bulb to pear shaped, guttulate, 16-21 X 14.5-18 µm.
Name of Depositor P Franken
Chain of Custody
ATCC <-- P Franken <-- S Verma
Isolation Arbuscular mycorrhizal spores in the rhizosphere soils of Prosopis juliflora and Zizyphus nummularia, Thar desert, Western India, India.
Cross References

Nucleotide (GenBank) : AF014929 nucleotide sequence of 5' region of 18S rRNA

References

Verma S, et al. Piriformospora indica, gen. et sp. nov., a new root-colonizing fungus. Mycologia 90: 896-903, 1998.

Zuccaro A, et al. Endophytic life strategies decoded by genome and transcriptome analyses of the mutualistic root symbiont Piriformospora indica. PLoS Pathogens 7(10): e1002290, 2011. PubMed: 22022265

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation