Zygosaccharomyces bisporus Naganishi, teleomorph (ATCC® 34890)

Strain Designations: NARD 3344 [CBS 6683]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Saccharomyces bisporus var. mellis (Fabian et Quinet) van der Walt, teleomorph
Strain Designations NARD 3344 [CBS 6683]
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
High benzoic acid tolerance
citrus juice spoilage
Morphology After 3 days at 25°C on YM agar, the cells are spherical to ellipsoidal, 2-5 x 3-9 μm, and occur singly, in pairs or in small clusters. Growth is butyrous and tannish-white in color.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 1245: YEPD
Growth Conditions Temperature: 20°C to 25°C
Atmosphere: Typical aerobic 
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence:

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATAGAAAAAATCTGATTGGCAAGTCAATGGGGCAGTAGAGTTTTTCGGCTCTTTCTTTTGCTTTTGGGCCTGCGCTTAGTTGCGCGGTCTAGAGTAGAGGGAGCTTCTACTGCTTCGGCTTACAATTTACACACAGTGGAGTTTCTACTATTTTTCTTCTTTGGGAGGATGATGAAAATCTATCTACTCCCAGAGGTAAACACAAACAATATTTTTATTTTTTATTTTACCCACAGTCAAATGAATACAAAAAAAAAATTATAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACACTTGTGTTTGGTAGTGAGTGATACTCTGTTAAAACTGGGTTAGCTTGAAATTGCAAGCCTTTTGGGGATGCGTCTAGAGAAGAGTTTTAGGCGGAAACGTCTGGCTCCTCCTCTATTTTCCTTTAACCAAATGTCGTATTAGGTTTTACCGACTCGGCAGACAGGTTACTGGAGACTGAGGTGGGTGATAGAAATATCGAACTTTTCTGCGCGCCTTTGGCAAACAATACTCTCTAAGCTTGACCTCAAATCAGGTAGGATTAC

Morphology After 3 days at 25°C on YM agar, the cells are spherical to ellipsoidal, 2-5 x 3-9 μm, and occur singly, in pairs or in small clusters. Growth is butyrous and tannish-white in color.
Name of Depositor AM van Grinsven
Isolation
Flavored sugar syrup, Iraq
References

Sand FE, van Grinsven AM. Comparison between the yeast flora of Middle Eastern and Western European soft drinks. Antonie van Leeuwenhoek 42: 523-532, 1976. PubMed: 1087865

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation