Cryptococcus musci (ATCC® 64321)

Strain Designations: H24 [CCY 29-18-3]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Apiotrichum curvatum (Diddens et Lodder) von Arx et Weijman, anamorph
Classification Cryptococcus musci
Strain Designations H24 [CCY 29-18-3]
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Preceptrol® no
Morphology After 5-6 days on YM at 25°C colonies are brownish, mucoid, dull soft and smooth. Cells are ovoidal to sausage shaped, often curved. Many cells show lateral budding. Pseudomycelium consists either of branched chains of short or pseudohyphae or long.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 1245: YEPD
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number: KC585408

TCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGGCCTTAGTGCCTAAAAACTATATCCCTAACACCTGTGAACTGTTGAATTGCGTCTTCGGATGCGGTTCTTTTACAAACATTGTGTAATGAACGTCATAACATTATAAACAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTGTCATGATCTCTCAACCAATAGGGTTTCTTATTGGCTTGGATCTGGGTGCTGCCAGCTTGTCTGGCTCGCCTTAAAGGAGTTAGCGAGTATAGCAATGTCGTCTGGCGTAATAAGTTTCGCTGGGTTGACGTGTGAAGCACGCTTCTAATCGCCCTCGGGCAATTTTTGACTCTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG

 

Large subunit ribosomal RNA gene, partial sequence; GenBank number: KC585415

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGTGAAGCGGGAAGAGCTCAAATTTGTAATCTGGCGTCCTTCGGGCGTCCGAGTTGTAATCTATAGAAGTGTTTTCCGTGCCGGACCATGTCCAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACATGACCACCGGTGCTCTGTGATACACTTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTCTTTGGACTCAGCCGGTTCTTCCGGTCTATTTCCTTTGAACGGGTCAACATCAGTTTTGTCCGGTGGATAAAGGCAGGAAGAAAGTGGCTCCCTCGGGAGTGTTATAGCTTTCTGTCACATACACTGGAGGAGACTGAGGACTGCAGCTCGCCTTTTGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGAC

Morphology After 5-6 days on YM at 25°C colonies are brownish, mucoid, dull soft and smooth. Cells are ovoidal to sausage shaped, often curved. Many cells show lateral budding. Pseudomycelium consists either of branched chains of short or pseudohyphae or long.
Name of Depositor A Kockova-Kratochvilova
Isolation
Scleroderma citrinum fruiting body, Czechoslovakia.
Cross References

Nucleotide (GenBank) : KC585408 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Nucleotide (GenBank) : KC585415 Large subunit ribosomal RNA gene, partial sequence

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation