Exserohilum turcicum (Passerini) Leonard et Suggs, anamorph (ATCC® 64835)

Alternate State: Trichometasphaeria turcica Luttrell, teleomorph  /  Strain Designations: 2-11  /  Product Format: frozen

Strain Designations 2-11
Alternate State Trichometasphaeria turcica Luttrell, teleomorph
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Race
Race 4
Morphology On Potato dextrose agar at 25°C after 7 days colonies spreading, woolly or hairy, brown, grey or black. Conidiophores emerging singly or in groups through stomata. Conidia straight or slightly curved, ellipsoidal to obclavate, pale to mid straw-colored, smooth with 4-9 pseudoseptate.
Medium Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAGGGATCATTACACAAAGATATGAAGGTAGGGTACTGGCAACAGTGCTCTGCTGAAATATTTTCACCCATGTCTTTTGCGCACTTTTTGTTTCCTGGGCGAGTTTGCTCGCCACCAGGACCCCCATATGAACCTTTTTTGTTTTTGCACTCAGCGTCAGTACAATAATTTAATCTATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTATTGTCTCTCCGTCTCGGGGAGACTCGCCTTAAAACAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAATTTGCGCTTGCAATCAGCCAAGGGCGGCATCCATGAAGCCTTTTTTCTCTCACATTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGGCGACATACCACCAGCCTAGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGC

Morphology On Potato dextrose agar at 25°C after 7 days colonies spreading, woolly or hairy, brown, grey or black. Conidiophores emerging singly or in groups through stomata. Conidia straight or slightly curved, ellipsoidal to obclavate, pale to mid straw-colored, smooth with 4-9 pseudoseptate.
Name of Depositor KJ Leonard
Chain of Custody
ATCC <-- KJ Leonard <-- RK Jones
Isolation
corn leaf, Zea mays, Texas