Exserohilum turcicum (Passerini) Leonard et Suggs, anamorph (ATCC® 64835)

Alternate State: Trichometasphaeria turcica Luttrell, teleomorph  /  Strain Designations: 2-11  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations 2-11
Alternate State Trichometasphaeria turcica Luttrell, teleomorph
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Race
Race 4
Morphology On Potato dextrose agar at 25°C after 7 days colonies spreading, woolly or hairy, brown, grey or black. Conidiophores emerging singly or in groups through stomata. Conidia straight or slightly curved, ellipsoidal to obclavate, pale to mid straw-colored, smooth with 4-9 pseudoseptate.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAGGGATCATTACACAAAGATATGAAGGTAGGGTACTGGCAACAGTGCTCTGCTGAAATATTTTCACCCATGTCTTTTGCGCACTTTTTGTTTCCTGGGCGAGTTTGCTCGCCACCAGGACCCCCATATGAACCTTTTTTGTTTTTGCACTCAGCGTCAGTACAATAATTTAATCTATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTATTGTCTCTCCGTCTCGGGGAGACTCGCCTTAAAACAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAATTTGCGCTTGCAATCAGCCAAGGGCGGCATCCATGAAGCCTTTTTTCTCTCACATTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGGCGACATACCACCAGCCTAGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGC

Morphology On Potato dextrose agar at 25°C after 7 days colonies spreading, woolly or hairy, brown, grey or black. Conidiophores emerging singly or in groups through stomata. Conidia straight or slightly curved, ellipsoidal to obclavate, pale to mid straw-colored, smooth with 4-9 pseudoseptate.
Name of Depositor KJ Leonard
Chain of Custody
ATCC <-- KJ Leonard <-- RK Jones
Isolation
corn leaf, Zea mays, Texas
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation