Sporobolomyces ruberrimus Yamasaki et Fujii ex Fell et al. (ATCC® 66500)

Strain Designations: 11 [CBS 7500, IFO 10566, JCM 3763, NRRL Y-17305]  /  Product Format: frozen

Deposited As Sporobolomyces ruberrimus Yamasaki et Fujii, anamorph
Classification Sporidiobolales, Sporidiobolaceae, Sporobolomyces
Strain Designations 11 [CBS 7500, IFO 10566, JCM 3763, NRRL Y-17305]
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Comments
authentic culture of Sporobolomyces ruberrimus
Morphology After 15 days on Blakeslee’s malt extract medium at 25°C, colonies are bright coral colored, cerebriform, butyrous. Cells are ovoid or cylindrical, single, in pairs, chains and clusters. Pseudohyphae is present.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GGATCATTATTGAAAACAAGGGTGTCCAATTTAACTTGGAACCCGAACTTCTCAATTCTAACTTTGTGCATCTGTATTATGGCGAGCAGTCTTCGGATTGTGAGCCTTCACTTATAAACACTAGTCTATGAATGTAAAATTTTTATAACAAATAAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCTCTGGTATTCCGGAGAGCATGTCTGTTTGAGTGTCATGAATTCTTCAACCCAATCTTTTCTTGTAATCGATTGGTGTTTGGATTTTGAGCGCTGCTGGCTTCGGCCTAGCTCGTTCGTAATACATTAGCATCCCTAATACAAGTTTGGATTGACTTGGCGTAATAGACTATTCGCTAAGGATTCGGTGGAAACATCGAGCCAACTTCATTAAGGAAGCTCCTAATTTAAAAGTCTACCTTTTGATTAGATCTCAAATCAGGCAGGATTACCCGCTGAACTTAAG

D1D2 region of the 26S ribosomal RNA gene.

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAAAGCTCAAATTTGTAATCTGGCGTCTTCGACGTCCGAGTTGTAATCTCGAGAAGTGTTTTCCGTGATAGACCGCATACAAGTCTCTTGGAACAGAGCGTCATAGTGGTGAGAACCCAGTACACGATGCGGATGCCTATTACTTTGTGATACACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACACATGCAGTGATACTTGCTATTCGGGGCAACTCGATTGGCAGGCCCGCATCAGTTTTTCGGGGCGGAAAAGCGTAGAGAGAAGGTAGCAATTTCGGTTGTGTTATAGCTCTTTACTGGATTCGCCCTGGGGGACTGAGGAACGCAGCGTGCTTTTAGCAATTCCTTCGGGAATTCCACGCTTAGGATGCGGGTTTATGGCTGTATATGAC

Morphology After 15 days on Blakeslee’s malt extract medium at 25°C, colonies are bright coral colored, cerebriform, butyrous. Cells are ovoid or cylindrical, single, in pairs, chains and clusters. Pseudohyphae is present.
Name of Depositor A Shiraishi
Chain of Custody
ATCC <-- A Shiraishi <-- I Yamasaki
Isolation
air, Fukuoka, Japan
Cross References

Nucleotide (GenBank) : AF070442 26S ribosomal RNA gene, partial sequence

References

Yamasaki I, Fujii H. Studies on Sporobolomyces red yeast. Part 7. Classification of the genera Sporobolomyces and Bullera. J. Agric. Chem. Soc. Jpn. 24: 11-15, 1950.

Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082