Sporobolomyces ruberrimus Yamasaki et Fujii ex Fell et al. (ATCC® 66529)

Strain Designations: 10 [CBS 7501, IFO 10567, JCM 3764]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Sporobolomyces ruberrimus var. albus Yamasaki et Fujii, anamorph
Classification Sporidiobolales, Sporidiobolaceae, Sporobolomyces
Strain Designations 10 [CBS 7501, IFO 10567, JCM 3764]
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Preceptrol® no
Comments
colorless mutant of ATCC 66500
Morphology On YM medium at 25°C after 2 days, colonies white to dingy white, somewhat gelatinous, forming pustules, shiny, raised. Cells elongated oval, smooth, contain oil droplets, occur singly or in chains.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GGATCATTATTGAAAACAAGGGTGTCCAATTTAACTTGGAACCCGAACTTCTCAATTCTAACTTTGTGCATCTGTATTATGGCGAGCAGTCTTCGGATTGTGAGCCTTCACTTATAAACACTAGTCTATGAATGTAAAATTTTTATAACAAATAAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCTCTGGTATTCCGGAGAGCATGTCTGTTTGAGTGTCATGAATTCTTCAACCCAATCTTTTCTTGTAATCGATTGGTGTTTGGATTTTGAGCGCTGCTGGCTTCGGCCTAGCTCGTTCGTAATACATTAGCATCCCTAATACAAGTTTGGATTGACTTGGCGTAATAGACTATTCGCTAAGGATTCGGTGGAAACATCGAGCCAACTTCATTAAGGAAGCTCCTAATTTAAAAGTCTACCTTTTGATTAGATCTCAAATCAGGCAGGATTACCCGCTGAACTTAAG


D1D2 region of the 26S ribosomal RNA gene.

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAAAGCTCAAATTTGTAATCTGGCGTCTTCGACGTCCGAGTTGTAATCTCGAGAAGTGTTTTCCGTGATAGACCGCATACAAGTCTCTTGGAACAGAGCGTCATAGTGGTGAGAACCCAGTACACGATGCGGATGCCTATTACTTTGTGATACACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACACATGCAGTGATACTTGCTATTCGGGGCAACTCGATTGGCAGGCCCGCATCAGTTTTTCGGGGCGGAAAAGCGTAGAGAGAAGGTAGCAATTTCGGTTGTGTTATAGCTCTTTACTGGATTCGCCCTGGGGGACTGAGGAACGCAGCGTGCTTTTAGCAATTCCTTCGGGAATTCCACGCTTAGGATGCGGGTTTATGGCTGTATATGAC

Morphology On YM medium at 25°C after 2 days, colonies white to dingy white, somewhat gelatinous, forming pustules, shiny, raised. Cells elongated oval, smooth, contain oil droplets, occur singly or in chains.
Name of Depositor A Shiraishi
Chain of Custody
ATCC <-- A Shiraishi <-- I Yamasaki
Isolation Colorless mutant of ATCC® 66500™
Cross References

Nucleotide (GenBank) : AF189993 26S ribosomal RNA gene, partial sequence

References

Yamasaki I, Fujii H. Studies on Sporobolomyces red yeast. Part 7. Classification of the genera Sporobolomyces and Bullera. J. Agric. Chem. Soc. Jpn. 24: 11-15, 1950.

Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation