Cylindrocarpon sp. (ATCC® MYA-283)

Strain Designations: rn2c1 [ILLS 54720]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Fusarium oxysporum Schlechtendahl, anamorph
Strain Designations rn2c1 [ILLS 54720]
Application
potential biological control agent against Verticillium wilt disease
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Comments The DNA sequences of ITS, D1D2 and RPB1 regions of MYA-283 differ from the type strain of Cylindrocarpon olidum ATCC 16548 (CBS 215.67) by mismatches of 4, 3 and 9 nucleotide positions, respectively.
Morphology After 6 days on Potato dextrose medium at 25°C, colony is flat, white to buff, reverse orange-brown. Macroconidia hyaline, fusiform, slightly curved 3-5 septate.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 335: Potato carrot agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCTACGTTGCTTCGGCGGACCACCCCAACCCCCTCGGGGCGAGGGGCCGCCAGAGGACCCAAAACCCAACTGTTTTTTCCGTAACGAAACCTATTCTGAGTGGAATTATTAAATAAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAACCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTACTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCGGGCTCGGTGTTGGGGATCGGCACAAGGCGGAGGCTCCCCCGGGAGCCCCCCCGCCCGCCGTCCCCCAAATGCAGTGGCGGTCACGTCGCGGCCCCCCGTGCGTAGTAGCAACACCTCGCACCGGAGCCCGTCGTGCCCACGCCGTAAAACCCCCGACTTTTACAAGGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAG

 

D1/D2 region of 28S ribosomal RNA gene; GenBank number: KC585414

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCAAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCGCGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGATTATGACCAGACTTGGGCCTGTTTGATCAGCTTGGGTTCTCCCGGGTGCACTCTCTCAGGCTCAGGCCAGCATCAGTTCGTCGCGGGGGACAAAGGTCGCGGGAATGTAGCTCCCCTCGGGGAGTGTTATAGCTCGCTTCGCAATACCCTGCCTCGGACTGAGGTTCGCGCATCTtGCAAGGATGCTGGCGTAATGGTCATCATCGAC
Morphology After 6 days on Potato dextrose medium at 25°C, colony is flat, white to buff, reverse orange-brown. Macroconidia hyaline, fusiform, slightly curved 3-5 septate.
Name of Depositor E Grunden
Isolation
Microsclerotia of Verticillium daliae, Rutan Woods, Ogden, IL, USA
Cross References

Nucleotide (GenBank) : AF176656 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Nucleotide (GenBank) : KC585414 Large subunit ribosomal RNA gene; partial sequence

References

Eric Grunden, personal communication

Chaverri P et al. Delimitation of Neonectria and Cylindrocarpon (Nectriaceae, Hypocreales, Ascomycota) and related genera with Cylindrocarpon-like anamorphs. Studies in Mycology 68:57-78, 2011. PubMed: 21523189

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation