Hannaella pagnoccae (ATCC® MYA-4530)

Strain Designations: BI118 [CBS11142]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations BI118 [CBS11142]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Morphology On YM medium at 25°C after 3 days, colonies creamy white to tan, butyrous to mucoid, dull, margin entire. Cells hyaline, elongated ovoid, smooth, 4.5-10.5 X 2.5-4.5 µm. Pseudohyphae not observed.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

AAGGATCATTAATAAATGTTACTTCGGTAACTTAATTAATCCCTAACACCTGTGCATCTTGTCGCTTCGGCGTCATTTTATAAACAACAGTGTAATGAATGTAATGTATTATAACAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTGAGTGTCATATAGACTCTTATACCTAGTTTTCTATGTATGAGCTTTGGACGTTGCCATTCTGTGGCTCGTCTTAAATGTCTAAGTGGAATGCGTAATAAGTTTTCGCTCCCTCCACTCTAATACTCTTTAGTTTAGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTAAAATCTAGCGTCCTCAGGGCGTTCGAGTTGTAATCTACAGACGCGTTTTCTGCGCTGGACTGTGTCCAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACAACAACCAGTGCTCTGTGATACGTGTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTGATCAGTTTCAGCTAGTTCTGCTAGTGTATTGCTGGTCAACGGGTCAACATCAGTTATATTCGGTGGAAAAAGGCATAGAGAATGTAGCACCTCCGGGTGTGTTATAGCTCTGTGTCTCATACACTGGACGTGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGA

Morphology On YM medium at 25°C after 3 days, colonies creamy white to tan, butyrous to mucoid, dull, margin entire. Cells hyaline, elongated ovoid, smooth, 4.5-10.5 X 2.5-4.5 µm. Pseudohyphae not observed.
Name of Depositor P Valente
Chain of Custody ATCC <-- P Valente
Isolation Bromeliad leaves, Itapua Park, Viamao, Rio Grande Do Sul, Brazil.
Cross References

Nucleotide (GenBank) : KC169793 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : FJ828959 26S ribosomal RNA gene

References

Landell MF, et al. Hannaella pagnoccae sp. nov., a tremellaceous yeast species isolated from plants and soil. Int. J. Syst. Evol. Microbiol. 64(6): 1970-1977, 2014. PubMed: 24614844

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation