Hannaella pagnoccae (ATCC® MYA-4530)

Strain Designations: BI118 [CBS11142]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations BI118 [CBS11142]
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Morphology On YM medium at 25°C after 3 days, colonies creamy white to tan, butyrous to mucoid, dull, margin entire. Cells hyaline, elongated ovoid, smooth, 4.5-10.5 X 2.5-4.5 µm. Pseudohyphae not observed.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

AAGGATCATTAATAAATGTTACTTCGGTAACTTAATTAATCCCTAACACCTGTGCATCTTGTCGCTTCGGCGTCATTTTATAAACAACAGTGTAATGAATGTAATGTATTATAACAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTGAGTGTCATATAGACTCTTATACCTAGTTTTCTATGTATGAGCTTTGGACGTTGCCATTCTGTGGCTCGTCTTAAATGTCTAAGTGGAATGCGTAATAAGTTTTCGCTCCCTCCACTCTAATACTCTTTAGTTTAGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTAAAATCTAGCGTCCTCAGGGCGTTCGAGTTGTAATCTACAGACGCGTTTTCTGCGCTGGACTGTGTCCAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACAACAACCAGTGCTCTGTGATACGTGTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTGATCAGTTTCAGCTAGTTCTGCTAGTGTATTGCTGGTCAACGGGTCAACATCAGTTATATTCGGTGGAAAAAGGCATAGAGAATGTAGCACCTCCGGGTGTGTTATAGCTCTGTGTCTCATACACTGGACGTGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGA

Morphology On YM medium at 25°C after 3 days, colonies creamy white to tan, butyrous to mucoid, dull, margin entire. Cells hyaline, elongated ovoid, smooth, 4.5-10.5 X 2.5-4.5 µm. Pseudohyphae not observed.
Name of Depositor P Valente
Chain of Custody ATCC <-- P Valente
Isolation Bromeliad leaves, Itapua Park, Viamao, Rio Grande Do Sul, Brazil.
Cross References

Nucleotide (GenBank) : KC169793 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : FJ828959 26S ribosomal RNA gene

References

Landell MF, et al. Hannaella pagnoccae sp. nov., a tremellaceous yeast species isolated from plants and soil. Int. J. Syst. Evol. Microbiol. 64(6): 1970-1977, 2014. PubMed: 24614844

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation