Bandoniozyma complexa (ATCC® MYA-4603)

Strain Designations: MA28a [CBS 11570]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Cryptococcus sp.
Classification Fungi, Basidiomycota, Agaricomycotina, Tremellomycetes, Incertae sedis, Tremellales, Tremellaceae
Strain Designations MA28a [CBS 11570]
Biosafety Level 1
Product Format frozen
Storage Conditions -70°C or colder
Type Strain yes
Preceptrol® no
Comments Ferments glucose
Morphology On YM medium at 25°C after 3 days, White to creamy white, smooth circular to slightly irregular, entire margin becoming filamentous with age, dull, raised. Cells smooth, globose to subglobose, single, 2.25-4.5 X 2.25-4.5 µm. Pseudohyphae observed after 16 days.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number KC113636:

AAGGATCATTATTGATTGGCCTAACGGCCGTTTCATTAACTCCAAACCTCTGTGAACCGTTGACCTCCGGGTCTATACAAACATTAGTGTAATGAACGTCTTTGTATTTTAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTGAGTGTCATGAAATCTCAACCCCTCCAGGTTTCTGATCTGGGGGCGGCTTGGACTTGGACGTGTGCCAGCTAATGGCTCGTCTTAAAAGGATTAGTGGAATCTCGACATCCACGGCAGACGTAATAAGTTTCGTCTCGCCTCTTGTCGTAGGTCTGCTCACAACCTGCCATCGCGCACCTTTATGACTCTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene; GenBank number KC113632:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAACCGGGATGAGCTCAAATTTGAAATCTGGCGTCCTCAGGGCGTCCGAGTTGTAATCTATAGAGGCGTTTTCCGTGCCGGACCGTGTCCAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGACGACCGGTGCTCTGTGATACGTCTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAGTTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGACTGTTGGGCTCAGCAGGTTCTGCCTGTGTATTCCCTTCAGTCGGGTCAACATCAGTTTTGACCGGTGGATAAGGGCAGCAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTGTCGTCGCATACATCGGTCGAGACTGAGGAACGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTCCGAGCTTAGGATGTTGACATAATGGCTTTAAACGA

Morphology On YM medium at 25°C after 3 days, White to creamy white, smooth circular to slightly irregular, entire margin becoming filamentous with age, dull, raised. Cells smooth, globose to subglobose, single, 2.25-4.5 X 2.25-4.5 µm. Pseudohyphae observed after 16 days.
Name of Depositor P Valente
Chain of Custody ATCC <-- P Valente
Isolation Air sample from timber factory, Rio Grande do Sul, Brazil.
Cross References

Nucleotide (GenBank) : KC113632 D1/D2 region of 28S rRNA gen

Nucleotide (GenBank) : KC113636 ITS including 5.8S rRNA gene

References

Valente P, et al. Bandoniozyma gen. nov., a genus of fermentative and non-fermentative tremellaceous yeast species. PLoS ONE, 7: e46060, 2012. PubMed: 23056233

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation