Bandoniozyma glucofermentans Suh et Blackwell (ATCC® MYA-4761)

Strain Designations: BG02-7-16-015A-1-1  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations BG02-7-16-015A-1-1
Application
ferments glucose
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Comments
insect associated yeast
Morphology On MD-200 at 25°C after 3 days, colonies white to cream, mucoid, glistening, smooth, margin filamentous. Cells ellipsoidal to ovoidal, 4.5-6.75 µm X 3-4.5 µm, multilateral budding, pseudohyphae present.
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions Temperature: 20-25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGATTGGCCTAACGGCCGTTTCATTAATCCCAAACCTCTGTGAACTGTTGACCTCCGGGTCTATACAAACATTAGTGTAATGAACGTCTTTGTATTTTAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTGAGTGTCATGAAATCTCAACCCCTCCAGGTTTCTGATCTGGTGGTGGCTTGGACTTGGACGTGTGCCAGCTAATGGCTCGTCTTAAAAGGATTAGTGGAATCTTGACATCCACGGCAGACGTAATAAGTTTCGTCTCGCCTCTTGTCGTAGGTCTGCTTACAACCTGCCATCGTGCACTTTATGACTCTGGCCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATC

Morphology On MD-200 at 25°C after 3 days, colonies white to cream, mucoid, glistening, smooth, margin filamentous. Cells ellipsoidal to ovoidal, 4.5-6.75 µm X 3-4.5 µm, multilateral budding, pseudohyphae present.
Name of Depositor M Blackwell
Special Collection ATCC
Chain of Custody
ATCC <-- M Blackwell
Isolation
Canthon sp. (Scarabaeidae), Barro Colorado Island, Panama
Cross References

Nucleotide (GenBank) : JN882303 ITS including 5.8S rRNA gene

References

Valente P, et al. Bandoniozyma gen. nov., a genus of fermentative and non-fermentative tremellaceous yeast species. PLoS ONE, 7: e46060, 2012. PubMed: 23056233

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation