Bandoniozyma glucofermentans Suh et Blackwell (ATCC® MYA-4761)

Strain Designations: BG02-7-16-015A-1-1  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations BG02-7-16-015A-1-1
Application
ferments glucose
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Comments
insect associated yeast
Morphology On MD-200 at 25°C after 3 days, colonies white to cream, mucoid, glistening, smooth, margin filamentous. Cells ellipsoidal to ovoidal, 4.5-6.75 µm X 3-4.5 µm, multilateral budding, pseudohyphae present.
Medium Medium 200: YM agar or YM broth
Growth Conditions Temperature: 20-25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGATTGGCCTAACGGCCGTTTCATTAATCCCAAACCTCTGTGAACTGTTGACCTCCGGGTCTATACAAACATTAGTGTAATGAACGTCTTTGTATTTTAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTGAGTGTCATGAAATCTCAACCCCTCCAGGTTTCTGATCTGGTGGTGGCTTGGACTTGGACGTGTGCCAGCTAATGGCTCGTCTTAAAAGGATTAGTGGAATCTTGACATCCACGGCAGACGTAATAAGTTTCGTCTCGCCTCTTGTCGTAGGTCTGCTTACAACCTGCCATCGTGCACTTTATGACTCTGGCCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATC

Morphology On MD-200 at 25°C after 3 days, colonies white to cream, mucoid, glistening, smooth, margin filamentous. Cells ellipsoidal to ovoidal, 4.5-6.75 µm X 3-4.5 µm, multilateral budding, pseudohyphae present.
Name of Depositor M Blackwell
Special Collection ATCC
Chain of Custody
ATCC <-- M Blackwell
Isolation
Canthon sp. (Scarabaeidae), Barro Colorado Island, Panama
Cross References

Nucleotide (GenBank) : JN882303 ITS including 5.8S rRNA gene

References

Valente P, et al. Bandoniozyma gen. nov., a genus of fermentative and non-fermentative tremellaceous yeast species. PLoS ONE, 7: e46060, 2012. PubMed: 23056233

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation