Dictyostelium simplex Cavender et al. (ATCC® MYA-4860)

Strain Designations: OH 598  /  Product Format: frozen

Classification Dictyosteliales, Dictyostelium
Strain Designations OH 598
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Morphology On LY agar after 10 days at 20°C, Sorocarps solitary erect solitary to clustered and variable in height.
Medium Medium 579: LY Agar for Filobasidium
Medium 2432: wMY (weak Malt Yeast Extract)
Medium 2219: Corn meal agar, half-strength
Growth Conditions Temperature: 20°C to 25°C
Atmospheric: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence:

GAAACTGCAGACGGCTCATTACAACAGTGATAAACTAATAGAGTTTCGGGTCTAACCTACCTGGATATCCGCAGTAAATCGGGGCTAATACATACAAACGAGGGGTGACTGTTTACGGGAGCTCCGCGATTATTAGTCTAGCCAATACCCGCAAGGGTTTTGTGGTGAAACCGAATAATATTGCAGATCGAAATCTAATTTCGACAATTCTATTGTGTCACTGCCCTATCAACTTTCGATGGTACGGTATTGGCCTACCATGGTTGTAACGGGTAACGGAGAATTAGGGTTCGATTCCGGAGAGGGCGCCTGAGAAATGGCGACCACTTCTACGGAAGGCAGCAGGCGCGCAAATTACTCAATCCCAATACGGGGAAGTAGTGACAATAAATATTAATGCCTATTCGTTTTTCGAAAGGTAATTAAAATGGGTACAAATTAAATCCCTTAACTAATACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCATATACTAAAGTTGTTGCGGTTAAAAAGCTCGTAGTTGAAACTAAATTTGTATTGGGTCCAAGTTCCTAGCCACTTTGGTGGTTACGGAATTCCAGTGCATTTTTTTAAACCTGCCCTTAAAGCCTCTACTTTGTAGTTGGTTTTCTTGGGTACTTCACTGTGAGAAAATTGTGGTGTTCAAAGCGGGCGTCTCGCCTGATCTTTTGCAGCATGGTATGATAAAACATGACATTTTGTGCAATTGGTTGCATTTAAGTGTAATGATTAATAGGGATGGATGGGGGTGTTCATATTGGTGGGCGAGAGGTGAAATTCGTTGACCCTATCAAGATGAACTTCTGCGAAAGCATTCATCAAATACTTCCCCATTAATCAAGAACGAAAGTTTGGGGATCAAAGACGATCAGATACCGTCGTAGTCCAAACTATAAACTATGTCGACCAGGGATCGGTTAATATTTTTTAAAAATTTACTCGGCACCTTGTGAGAAATCATGAGTGTTTAGATTCTGGGGGGAGTATGGTCGCAAGTCTGAAACTTAAAGGAATTGACGGAAGGGCACACAATGGAGTGGAGCCTGCGGCTTAATTTGACTCAACTCGGGAAAACTTACCAAGCTAAGATATAGTAAGGATTGACAGACTAAAAGATTTTTCATGATTCTATAAGTGGTGGTGCATGGTCGTTCTTAGTTGGTGGAGCAATCTGTCTGGTCAATTCCGATAACGGACGAGATCTCGACCTGCTAACTAGTAGTACTTATTCGGTCGATATGAGTGAAGGCTCTCAAGGAGTAAGTTGTGCGTCGCAAGGTGCATGACACTTCGGGGGGTTTGTAACTTGATCAGATATGTACGATTTTAAAAACTTCTTAGAGGGACTACCTGTGGCAAACAGGGGGAAGTTCGAGGCAATAACAGGTCTGTGATGCCCTTAGATACCTTGGGCCGCACGCGCGCTACAATGTAATAGGCAAAAAGCTCTCCTGGTCCGGAAGGATTGGGTAATCATATGAATTTATTACGTAACTGGGCTTGATCTTTGTAATTATTGATCATCAACGAGGAATTCCTTGTAAGCGCAAATCATTACTTTGCGCTGAATATGTCCCTGCCCTTTGTACACACCGCCCGTCGCTCCTACCGATCGAATGATACGGTAAAGCCAACGGATAAGATTCTGTAGCAATACGTGAATTTTAAAAGT

Morphology On LY agar after 10 days at 20°C, Sorocarps solitary erect solitary to clustered and variable in height.
Name of Depositor J.C. Landolt
Chain of Custody ATCC <-- J.C. Landolt; Shepherd University <-- J.C. Cavender
Isolation Soils collected from the semi-green rain forest of Tikal, Guatemala.
References

Cavender JC, et al. New small dictyostelids from seasonal rainforests of Central America. Mycologia 105: 610-635, 2013. PubMed: 23396155