Dictyostelium angelicum Cavender et al. (ATCC® MYA-4866)

Strain Designations: 38BO  /  Product Format: frozen

Permits and Restrictions

View Permits

Classification Dictyosteliales
Strain Designations 38BO
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain yes
Genotype Not available
Preceptrol® no
Comments Grown in two-member culture with Escherichia coli (ATCC 23437)
Morphology On LY agar after 10 days at 20°C, Sorocarps erect to prone, solitary to loosely clustered and variable in height.
Sequenced Data
18S ribosomal RNA gene, partial sequence:

GAAACTGCAGACGGCTCATTACAACAGTGATAAACTAATAGAGTTTCGGGTCTAACCTACATGGATATCCGCAGTAAATCGGGGCTAATACATACAAACGAGGGGTGACTGTTTACGGAAGCTCCGCGATTATTAGTCTAGCCAATACCCGCAAGGGTTTTGTGGTGAAACCGAATAATATTGCAGATCGAAATCTGATTTCGACAATTCTATTGTGTCACTGCCCTATCAACTTTCGATGGTACGGTATTGGCCTACCATGGTTGTAACGGGTAACGGAGAATTAGGGTTCGATTCCGGAGAGGGCGCCTGAGAAATGGCGACCACTTCTACGGAAGGCAGCAGGCGCGCAAATTACTCAATCCCAATACGGGGAAGTAGTGACAATAAATATTAATGCCTATTCGTTTTTCGAAAGGTAATTAAAATGGGTACAAATTAAATCCATTAACTAATACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCATATACTAAAGTTGTTGCGGTTAAAAAGCTCGTAGTTGAAACTAAATTTGCATTGGGTCAAAGTTTCTAGCCACTTTGGTGGTTACGAAATTCCAGTGCATTTTTTTAAATCTGCCCTTAAAGCCTCTACTTTGTAGTTGGTTTTCTTGGGTACTTCACTGTGAGAAAATTGTGGTGTTTAAAGCGGGCGTCTCGCCTGATCTTTTGCAGCATGGTATGATAAAACATGACATTTTGTGCAATTGGTTGCATTTAAAGTGTAATGATTAATAGGGATGGATGGGGGTGTTCATATTGGTGGGCGAGAGGTGAAATTCGTTGACCCTATCAAGATGAACTTCTGCGAAAGCATTCATCAAATACTTCCCCATTAATCAAGAACGAAAGTTTGGGGATCAAAGACGATCAGATACCGTCGTAGTCCAAACTATAAACTATGTCGACCAGGGATCGGTTAATATTTTTTAAAAATTTACTCGGCACCTTGTGAGAAATCATGAGTGTTTAGATTCTGGGGGGAGTATGGTCGCAAGTCTGAAACTTAAAGGAATTGACGGAAGGGCACACAATGGAGTGGAGCCTGCGGCTTAATTTGACTCAACTCGGGAAAACTTACCAAGCTAAGATATAGTAAGGATTGACAGACTAAAAGATTTTTCATGATTCTATAAGTGGTGGTGCATGGTCGTTCTTAGTTGGTGGAGCAATCTGTCTGGTCAATTCCGATAACGGACGAGATCTCGACCTGCTAACTAGTAGTACTTATTCGGTCGATATGAGTGAAGGCTCTCAGGGAGTAAGTTGTGCGTCGAAAGGTGTATGACACTTCGGGGGGTTTGTAACTTGACCAGATATGTACGATTTTAAAAACTTCTTAGAGGGACTACCTGTGGCAAACAGGGGGAAGTTCGAGGCAATAACAGGTCTGTGATGCCCTTAGATACCTTGGGCCGCACGCGCGCTACAATGTAATAGGCAAAAAGCTCTCCTGGTCCGGAAGGATTGGGTAATCATATGAATTTATTACGTAACTGGGCTTGATCTTTGTAATTATTGATCATCAACGAGGAATTCCTTGTAAGCGCAAATCATTACTTTGCGCTGAATATGTCCCTGCCCTTTGTACACACCGCCCGTCGCTCCTACCGATCGAATGATACGGTAAAGCCAACGGATAAGATTCTGTAGCAATACGTGAATTTTAAAAGTTGTTTAAATCTCATTGT

Morphology On LY agar after 10 days at 20°C, Sorocarps erect to prone, solitary to loosely clustered and variable in height.
Name of Depositor J.C. Landolt
Chain of Custody ATCC <--J.C. Landolt; Shepherd University
Isolation Soils and leaf mold collected from seasonal rain forest of southern Belize (Bladen Preserve), Belize.
References

Cavender JC, et al. Ten new small dictyostelids from seasonal rain forests of Central America. Mycologica 105(3): 610-635, 2013.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation