Aspergillus flavus Link, anamorph (ATCC® MYA-4921)

Strain Designations: FGSC A1244  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Aspergillus parasiticus
Strain Designations FGSC A1244
Application aflatoxin research
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Genotype Delta ku70 Delta pyrG
Preceptrol® no
Morphology After 7 days on Potato dextrose agar at 25°C, colonies olive-green, flat, powdery, mycelium white, reverse uncolored. Conidial heads radiate; stipes rough-walled, hyaline; vesicles pyriform, uniseriate. Conidia globose, smooth-walled, green.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 323: Malt agar medium
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCGTGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

Morphology After 7 days on Potato dextrose agar at 25°C, colonies olive-green, flat, powdery, mycelium white, reverse uncolored. Conidial heads radiate; stipes rough-walled, hyaline; vesicles pyriform, uniseriate. Conidia globose, smooth-walled, green.
Name of Depositor FGSC
Chain of Custody ATCC <-- FGSC <-- Chang PK
Isolation Derived from aflatoxigenic Aspergillus flavus strain CA14
References

Chang PK, Horn BW, Dorner JW. Clustered genes involved in cyclopiazonic acid production are next to the aflatoxin biosynthesis gene cluster in Aspergillus flavus. Fungal Genet. Biol. 46: 176-182, 2009. PubMed: 19038354

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation