Fusarium verticillioides (Saccardo) Nirenberg (ATCC® MYA-4922)

Strain Designations: FGSC 7600 [A-00149, M3125]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Fusarium verticilliodes
Strain Designations FGSC 7600 [A-00149, M3125]
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Genotype VCG A7
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type mating type A-
Comments

Genome sequencing strain (Broad Institute, USA).

Morphology After 4 days on potato dextrose medium at 25°C, colony is white, cottony, tinged with purple. Microconidia abundant, single-celled, oval, formed in false heads on monophialides. Macroconidia present, sickle-shaped to straight, 3-5 septate.
Medium Medium 200: YM agar or YM broth
Medium 323: Malt agar medium
Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCAGCTTGGTGTTGGGACTCGCGAGTCAAATCGCGTTCCCCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAG


Partial caM gene for calmodulin.

TCTTTGTAAGCTATCCCCTTTGTTTCGCCGCCTTGCCTAGCCGGGTCTTGTGAGAAGCTGTCGCTAACCTCTTTATGTAGGACAAGGATGGCGATGGTGAGTGATGCTCCCCTTCCTGCGATGTTTCTCCGTTGGCCCCGTGCGAAACCCAAATCGATCCAACAAAGCATGCATCAGACCACTATAATCCTTTACATCTCTGTCTATGCGATATTCTTAAATCGAAAACATGAGCTAAACGCCTCGCTCTAGGCCAGATTACCACCAAGGAGCTCGGTACCGTTATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCTGAGCTTCAGGACATGATCAACGAGGTTGACGCTGACAACAACGGCACCATCGACTTTCCTGGTTCGTAGTATCCCAAGACGATTATAGGACGGTCGAGTACTAACCATTAGGTAAAGAGTTCCTTACCATGATGGCC

Morphology After 4 days on potato dextrose medium at 25°C, colony is white, cottony, tinged with purple. Microconidia abundant, single-celled, oval, formed in false heads on monophialides. Macroconidia present, sickle-shaped to straight, 3-5 septate.
Name of Depositor FGSC
Chain of Custody ATCC <-- FGSC <--Leslie JF
Isolation Maize, Visalia, CA, USA
Cross References

Complete Genome (GenBank) : AAIM00000000 Fusarium verticillioides 7600, whole genome shotgun sequencing project

References

Ma LJ, et al. Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium. Nature 464: 367-373, 2010. PubMed: 20237561

Xu JR, et al. Electrophoretic karyotypes distinguish the biological species of Gibberella fujkuroi (Fusarium section Liseola). Mol. Plant-Microbe Interact. 8: 74-84, 1995.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation