Phytophthora stagnum (ATCC® MYA-4926)

Strain Designations: 43F3  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations 43F3
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain yes
Preceptrol® no
Morphology On V8 rye medium at 25°C after 7 days, mycelium creamy white to dingy white, velvety to appressed, thin to semi dense. Hyphae hyaline, guttulate.
Medium ATCC® Medium 321: Lima bean agar
ATCC® Medium 343: V8 juice agar
ATCC® Medium 1970: V8 rye agar
Growth Conditions Temperature: 20°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

TTAAATACTGAACATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGAGGATATGCCAGACGTGAAGTGTCTTGCTGGCGGTCTTTCGAGTCTGCCGGTGAGTCCTTTGAAATGTACTGAACTGTACTCTCTCTTTGCTCGAAAAGCGTGGCGTTGCTGGTTGTGGAGGCTGCCCGTGTGGCCAGTCGGCGACCGGTTTGTTAGCTGTGGCGTTTAATGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAATCTGCTTATTGKGTGCTTTTCCTGTCATTGGCGGTACGAACTGGTGAACCGTAGCTGTGTGGTGCTTGGCTTTTGAACCGGCTTTGCTTTGCGAAGTAGGGTGGCGGCTTCGGCTGTCGAGGGGTCGATCCATTTTGGGAAACTTTGTGTGTGCGGCTTCGTGCTGCGC


D1D2 region of the 28S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGCGCGTGCGCTGTGGCAGCGGCTTTTTTGGCTGCGCTCGGTGCGTGTGTTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCCTTAACTTGTCGCCGTTCGGGACGTTGACGAAATGGAGCGATCCGA

Morphology On V8 rye medium at 25°C after 7 days, mycelium creamy white to dingy white, velvety to appressed, thin to semi dense. Hyphae hyaline, guttulate.
Name of Depositor C Hong
Chain of Custody ATCC <-- C Hong
Isolation Reservoir water, Virginia, USA.
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation