Psathyrella aquatica Frank et al. (ATCC® MYA-4928)

Strain Designations: Pa003JLF  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Psathyrella aquatica
Strain Designations Pa003JLF
Application Wood decomposer fungus
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Genotype Not available
Preceptrol® no
Comments Aquatic gilled mushroom
Morphology On YM medium at 25°C after 7 days, mycelium white, velutinous, dense. Hyphae hyaline, guttulate, clamp connections present. Chlamydospores globose, hyaline, 10.5-16.5 X 10.5-13.5 µm.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

AAGGATCATTAATGAATATCTATGGCGTTGGTTGTTGCTGGCTCCTAGGAGCATGTGCACGCCCGTCATTCATATCTTTCCACCTGTGAACTCACTGTAGGTCTGGATAACTCTCGCTTACCCAAGCGGAAGCAAGGATTGCTGCGTCGCAAGGCCGGCTCTCTTTGAATTTCCAGGTCTATGTCTTTACACACCCCAATTGAATGATAACGAATGTAGTCAATGGGCTCTAAGCCTATAAAAACACAATACAACTTTTAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTGTCATGAGACTGTGTAAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCCTCAGTGCGGTCTGCTCCCCTGAAATGCATTAGCGAGTTCAAACTGGGCTCCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGGGGCTTAGACTTGCTTCTAACCGTCCGCAAGGACAACTTTTGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTGGTCTTTGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTCGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCGAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCGGAAATCAGCCTTGCTTTTGCTGGGTGTACTTTCTGGTTGACGGGCCAGCATCAGTTTTGACCGGTGGAAAAAGGTCAAGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTTGGTTGTATGCATCGGTTGGGACTGAGGAACTCAGCACGCCGCAAGGCCGGGTCTTTGACCACGTTCGTGCTTAGGATGCTGGCATAATGGCTTTAATCGA

Morphology On YM medium at 25°C after 7 days, mycelium white, velutinous, dense. Hyphae hyaline, guttulate, clamp connections present. Chlamydospores globose, hyaline, 10.5-16.5 X 10.5-13.5 µm.
Name of Depositor J Frank
Chain of Custody ATCC <-- J Frank
Isolation Underwater, upper Rogue River near Crater Lake National Park, Oregon, USA.
References

Frank JI, Coffan RA, Southworth D. Aquatic gilled mushrooms: Psathyrella fruiting in the Rogue River in southern Oregon. Mycologia 102(1): 93-107, 2010 PubMed: 20120233

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation