Psathyrella aquatica Frank et al. (ATCC® MYA-4928)

Strain Designations: Pa003JLF  /  Product Format: frozen

Deposited As Psathyrella aquatica
Strain Designations Pa003JLF
Application Wood decomposer fungus
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Genotype Not available
Preceptrol® no
Comments Aquatic gilled mushroom
Morphology On YM medium at 25°C after 7 days, mycelium white, velutinous, dense. Hyphae hyaline, guttulate, clamp connections present. Chlamydospores globose, hyaline, 10.5-16.5 X 10.5-13.5 µm.
Medium Medium 200: YM agar or YM broth
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

AAGGATCATTAATGAATATCTATGGCGTTGGTTGTTGCTGGCTCCTAGGAGCATGTGCACGCCCGTCATTCATATCTTTCCACCTGTGAACTCACTGTAGGTCTGGATAACTCTCGCTTACCCAAGCGGAAGCAAGGATTGCTGCGTCGCAAGGCCGGCTCTCTTTGAATTTCCAGGTCTATGTCTTTACACACCCCAATTGAATGATAACGAATGTAGTCAATGGGCTCTAAGCCTATAAAAACACAATACAACTTTTAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTGTCATGAGACTGTGTAAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCCTCAGTGCGGTCTGCTCCCCTGAAATGCATTAGCGAGTTCAAACTGGGCTCCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGGGGCTTAGACTTGCTTCTAACCGTCCGCAAGGACAACTTTTGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTGGTCTTTGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTCGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCGAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCGGAAATCAGCCTTGCTTTTGCTGGGTGTACTTTCTGGTTGACGGGCCAGCATCAGTTTTGACCGGTGGAAAAAGGTCAAGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTTGGTTGTATGCATCGGTTGGGACTGAGGAACTCAGCACGCCGCAAGGCCGGGTCTTTGACCACGTTCGTGCTTAGGATGCTGGCATAATGGCTTTAATCGA

Morphology On YM medium at 25°C after 7 days, mycelium white, velutinous, dense. Hyphae hyaline, guttulate, clamp connections present. Chlamydospores globose, hyaline, 10.5-16.5 X 10.5-13.5 µm.
Name of Depositor J Frank
Chain of Custody ATCC <-- J Frank
Isolation Underwater, upper Rogue River near Crater Lake National Park, Oregon, USA.
References

Frank JI, Coffan RA, Southworth D. Aquatic gilled mushrooms: Psathyrella fruiting in the Rogue River in southern Oregon. Mycologia 102(1): 93-107, 2010 PubMed: 20120233