Lagenidium karlingii (ATCC® MYA-4937)

Strain Designations: MTLA-07  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations MTLA-07
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Genotype Not available
Preceptrol® no
Comments Animal pathogen
Morphology After 15 days on Emmons’ modification of Sabouraud’s medium at 30°C, colony is cream-colored, raised, wrinkled. Swollen, elongated structures are guttulate, variably shaped, some are papillate.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 307: Cornmeal agar
ATCC® Medium 663: PYG medium
Growth Conditions
Temperature: 30°C to 37°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AAGGATCATTACCACACCAAAAAAACATTTTCCACGTGAACCGTTGTCTGTATGGTTTGTACTGCTGCTCGTCTTCGGGCTTGTAGTGGCGGTTGAGCAATGCTTACGTTGATTGATTCGTCCTTGTGGCTGAGTCTCCGTGAGCGCCCATTTTTAAACCCTTTACCCATACCTCATTTTCTGATGCATACTCCGAGAACGAAAGTTCTTGGTTTTAACTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACAACGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAGATTTTGAACGCACATGGCACTCTCGAGTTTATTCTTGGGAGTATGTCTGTATCAGTGTCTGTTGTAAAAACTTGCCTTTTGTGTGTGTTTTCTTCGGAGAGCGTGCGCGACTGTGCAGAAGGTGAAGTGTCTTGCTGCGTGTTTTGTGCGGCGAGTCCTTTTAAATGCAGTTTGCTTCTGTGTGGTTCGAAGCATGCGTTTGCCTCGGAGGAGGTGATCGTGTTGGACTTGCACGTAAGGTTGACTTCAGCTGGAACGCTGTGGACAATGCCCAATTGAGTGGTATGTTGTGCACTTGTGCTCGACTTGTTACTAGATTGGTGTGTGGTCTGTTTCGGTGGGGGTCCTTTGTGTGTGATGTATTGATGCGGTTGCTGTTTGCACTTCTGGGCTTGAATGTGTGTGTTGGACTGCGCGTTTTACAACGGAGRCCTATTTGGGAAATGATTGTGTTTCGGCACATGGAACTTCAAATTGGACCTGATATCAGACAAGATTACCCGCTGAATTTAAG


D1D2 region of the 28S ribosomal RNA gene.

CATATAACTAAGCGGAGGAAAAGAAACTAACAAGGATTTCCCTAGTAACGGCGAGTGAAGCGGAAAGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATGGATGCGAAGTCAGAGTGTTCGCTCGGGTTAAGTTCCTTGGAAGAGGACAGCATTGAGGGTGATACTCCCGTGTGTACCTGAGTGATTGCTCGTACGACTCGTATTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAAAGTACCTGAAACTGTTGAAAGGGAAGCGAATCGTTTCCAGTGTAATGTTCATGGCATATTTCATTGGCGCGTTGGTTCGTGCGGTTTGTGGTGCAGTAGTTTATTCTACGCGTGCTGACTGCGTGTGGCTGGCTTGCTGGTGCCCTGTGCTGTGGATGGAGGTCAGAGTCAGTTTCTGCTGCGGGAAATGGCCGTGGAGGAGGTAGGTCGCGCTTCGGTGYGGCTGTTATACCTTTGCGTGCTAGTAGTCGTGGCGGAGACTGAGGTGCTTGCAACATGCTTTGAAGTCTTGCGGGTGTTTATCTGGTGTGTTGATGGGAAAGCTTGCTTTGCTGTTGGCGTCACTGGGTGATGATGTCTGTAAGTAACTTTRGCTGTTCGGGACTCTGGCGAAATGGAGCGATTCGA

Morphology After 15 days on Emmons’ modification of Sabouraud’s medium at 30°C, colony is cream-colored, raised, wrinkled. Swollen, elongated structures are guttulate, variably shaped, some are papillate.
Name of Depositor L Mendoza
Chain of Custody ATCC <-- L Mendoza
Isolation Dog tissue, USA
References

Mendoza L, et al. Description of four novel mammalian pathogens in the genus Lagenidium Unpublished manuscript.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation