Aspergillus callestemii (ATCC® MYA-4943)

Strain Designations: VRC 24  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations VRC 24
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments This strain has broad spectral antimicrobial activity
Morphology On PDA medium at 30°C after 21 days, mycelium white to cream becoming olive brown to dark brown, cottony with some tufts of mycelium. Reverse tan to brown becoming dark brown with white margin. Hyphae hyaline, guttulate. Conidiophors biseriate, vesicles globose. Conidia greenish brown, globose to subglobose, smooth, contain oil droplets, 2-4.5 X 3-3.75 µm.
Medium Medium 200: YM agar or YM broth
Medium 324: Malt extract agar
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 30°C to 37°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

AAGGATCATTACCGAGTGCGGGCCCCCTCGCGGGGCCCAACCTCCCACCCGTGTCTACCGTACCATGTTGCTTCGGCGGGCCCGCCGCAAGGCCGCCGGGGGGGCACCCGCCCCTCGGGCCCGCGCCCGCCGGAGACCCCAACACGAACACTGTCTGAATTAGTGGCGTCTGAGTCTACGTACAAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCCAGCCCGGCTGGTGTGTTGGGCCGCCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGTGGCGGCGCCGCGTCCGGTCCCCGAGCGTATGGGGCTCTGTCACCCGCTCCGTGGGCACCGGCCGGCTGCCGGCCTCGACCATCTTCCTTTTTTTCCAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene:

GGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTCCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCATCGGAGAGGGTGAGAATCCCGTCTGGGATGGGGAGTCCGCGCCCGTGTGAAGCGCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCGGGGTTCAGCCGGGACTCGTCCCGGTGCACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGCCGTTCAAAGGCCCCGGGAATGTAGCGCCCTTCGGGGCGCCTTATAGCCCGGGGTGCAATGCGGCCAGCCCGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGCAAACGA

Morphology On PDA medium at 30°C after 21 days, mycelium white to cream becoming olive brown to dark brown, cottony with some tufts of mycelium. Reverse tan to brown becoming dark brown with white margin. Hyphae hyaline, guttulate. Conidiophors biseriate, vesicles globose. Conidia greenish brown, globose to subglobose, smooth, contain oil droplets, 2-4.5 X 3-3.75 µm.
Name of Depositor R Vaddavalli
Chain of Custody ATCC <-- R Vaddavalli
Isolation Callistemon citrinus plant rhizosphere soil, Andhra Pradesh, Hyderabad, India.
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation