Penicillium citrinum Thom, anamorph (ATCC® MYA-4958)

Strain Designations: BDM-J  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Penicillium sp.
Strain Designations BDM-J
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments Utilizes polylactic acid as a sole carbon source
Minimally alters chain length of polymers
Morphology On PDA medium at 25°C after 5 days, mycelium white becoming green as conida develop, velutinous to woolly, becoming sulcate. Reverse bright yellow. Hyphae hyaline, guttulate. Conidiophore stipes verrucose, triverticulate. Phialides flask shaped. Conidia pale green, globose, smooth.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCCTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGAACGGCCCCCATCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGATGGGGTGGCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAATTGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCACTCGTGCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCTCTGGAAGGTAACGCCTCTCGGGGCGTCTTATAGCCAGGGGTGCCATGCGGCCTGCCCGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAGCGA


beta-tubulin gene:

GTCTGCCCCGAATCCGACGCGTCTTTGTTGACCTACCCCTGAACGGACCCCCCACTTGTTCATCTTGCTAACCTCACCTTTTTCCCAACATATAGGTTCACCTGCAGACCGGCCAGTGTGTAAGTGCACCTCGAATAATAATCGATTTCTTGGACAAGGAAGACACATTTAATATGATGGTTAATAAATGCTAAACGATATGTGGGGATCTATAGGGTAACCAAATTGGTGCCGCTTTCTGGTACGTGCTGCAAATCCTGAAAGATCAATTGTTGGATACAAAGAGCAATATACTGACCAATTCTATAGGCAAACCATTGCTGGCGAGCACGGCCTTGATGGCGATGGACAGTAAGTTCTTTCGACAAAGAAGTGTTTACGTTTTTTCGAGAATGGCGGTCTGATATTTTTGGGCAGCTACAACGGAACCTCCGATCTCCAGCTGGAGCGCATGAACGTCTACTTCACCCACGTAAGTGATACTGACCCCAATGCCATTGGAATCATTATCTAACCAACTATTGTTTGTTTTATCAATAGGCTTCAGGTGACAAGTATGTTCCCCGTGCCGTCCTGGTCGACTTGGAGCCCGGTACCATGGACGCTGTCCGTGCTGGTCCCTTCGGCAAGCTTTTCCGTCCCGAC


RPB2 gene:

AACGCTGCGTTGAGACCAACCGTGAGATTTACTTGAACATTGGTCTGAAGGCTGCAACTCTGACTAGTGGTCTCAAATATGCGCTTGCTACAGGTAACTGGGGTGAGCAAAAGAAGGCAGCTAGCGCCAAGGCTGGTGTTTCTCAAGTGTTGAGTCGTTATACATTTGCTTCCTCGCTGTCTCACTTGCGCCGTACAAACACGCCCATTGGTCGTGATGGTAAGATTGCCAAACCTCGTCAGCTTCATAATACACACTGGGGTCTGGTTTGTCCAGCCGAAACCCCCGAAGGACAGGCTTGTGGTCTTGTCAAGAATCTGGCGCTCATGTGCTACATCACTGTCGGTACTCCTAGCGAGCCTATTATCGACTTCATGATCCAGCGAAATATGGAAGTTTTGGAAGAGTTCGAGCCCCAAGTCACACCGAATGCCACGAAGGTCTTTGTTAATGGTGTCTGGGTCGGTATCCACCGTGATCCGTCGCATCTGGTGAACACTATGCAATCGCTGCGTCGACGCAACATGATCTCTCACGAAGTCAGTTTGATTCGGGATATCCGCGAGCGAGAGTTCAAGATTTTCACCGATACTGGACGTGTCTGTCGTCCATTGTTCGTTGTTGACAATGATCCCAAGAGCGAAAATGCTGGATCTTTGATTCTCAACAAGGAACATATTCACAAGCTTGAACAAGATAAGGACTTGCCACTTGATATGGACGTGGAAGAGCGCCGGGAGCGTTACTTCGGATGGGATGGTCTGGTTCGATCAGGAGCTGTCGAATACGTCGATGCAGAAGAAGAGGAGACGATCATGATCGTCATGACACCGGAAGATCTCGAGATCTCCAAACAGCTTCAAGCTGGCTATGCACTGCCCGAGGAGGAGACTAATGATCCGAACAAGCGAGTTCGCTCAATTCTTAGCCAGCGCGCCCACACCTGGACTCACTGTGA

Morphology On PDA medium at 25°C after 5 days, mycelium white becoming green as conida develop, velutinous to woolly, becoming sulcate. Reverse bright yellow. Hyphae hyaline, guttulate. Conidiophore stipes verrucose, triverticulate. Phialides flask shaped. Conidia pale green, globose, smooth.
Name of Depositor M Brodhagen
Chain of Custody ATCC <-- M Brodhagen
Isolation Soil-buried compostable plastic (polylactic acid), Knoxville, TN.
Cross References

Nucleotide (GenBank) : KF597147 18S ribosomal RNA gene, partial sequence

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation