Chaetomium sp. (ATCC® MYA-4959)

Strain Designations: BDM-GG  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations BDM-GG
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments Grows on, and physically degrades the compostable plastic ‘BioAgri’ when provided as sole carbon source
Morphology On PDA at 25°C after 5 days, mycelium creamy white to dingy white, velutinous to woolly, growing on and into the media. Reverse tan to mustard yellow. Hyphae hyaline, guttulate. Spores hyaline, globose to subglobose, thick walled, smooth to faintly textured, 12.5-19 X 11.5-17.5 µm.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

AGGGATCATTACAGAGTTGCAAAACTCCCTAAACCATTGTGAACGTTACCTTCAAACCGTTGCTTCGGCGGGCGGCCCGGGTCCGCCCGGTGCCCCCTGGCCCCCTAGCGGGGCGCCCGCCGGAGGAAACCCAACTCTTGATTATTATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCAGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAACCAGTGGCGGGCTCGCTGTCACACCGGGCGTAGTAGATTTTATCTCGCTCAGGGCGTGCTGCGGGTTCCGGCCGTTAAAAGCCTTTTTTACCCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene; GenBank number:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGCAGAGGAAGCTTTAGGCGCGGCACCATCTGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATAGATGGACGCCTAGCCTGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGATCATCCGGTGTTCTCACCGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGTGGGGGGATAAAGGCACCGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCGGGGCGTAATGCCCTCGCGGGGACCGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGA


beta-tubulin gene:

GCCTGTCCCTGCATACCTGCCCCACGACCCCGATAGCCTGCGACGCGTCTGGGATACTTTTCTGAGACCCTGATCTACCCCACACACTGGGAGGACGTCGTTCCACCAGCCCGACCGGCGCGAGAGCGGTCGCGGCGCTGCCATGATGGAATGTACACGATGCTGACTCTATCTTTCTACTACAGGTCCACCTCCAGACCGGCCAATGCGTAAGTTGGATCGATTCGAACACGGCAACCGACCGGATGGAGCGGATGGACTGACAAACAACCTCTCTAGGGTAACCAAATTGGTGCCGCTTTCTGGTATGTTCTGCCTCAACATCAAGCAATGACGTATCAAGACCAAGCAAGACTGACTTCCACCCCAGGCAGACCATTTCCGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGACCGTCGCCGATTCCCGGCCGATGAATCCCTCGCTCACCGCTTCGATAGGTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTGAGTCGGGCCCCGTACGCCTTCAGCCAGCCAAACGGCCGTGGTCGCTGACGACAAATATTCTGCAGGCGTCCGGCAACAAGTATGTCCCCCGTGCCGTCCTTGTCGACTTGGAGCCCGGCACCATGGATGCCGTCCGCGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTC


RPB2 gene:

CTGGTGTGTCCCAGGTGTTGAACCGTTACACCTTCTCCTCGACCTTGTCGCATTTGCGGCGTACCAACACACCCATTGGGCGCGACGGCAAACTGGCCAAGCCTCGCCAACTTCATAACACCCATTGGGGCCTTGTGTGTCCGGCAGAGACGCCGGAAGGCCAGGCTTGCGGTCTCGTCAAGAACCTGTCCCTGATGTGCTACGTTAGTGTGGGCACACCGGCGGACCCCATCGTCGAGTTCATGGTTGCCCGTGGTATGGAAGTGCTCGAGGAGTACGAGCCACTGCGGTACCCCAATGCAACCAAGGTGTTTGTCAACGGCACATGGGTCGGTGTACATCAGGACCCGAAACACCTGGTCACCCTGGTTCAGGGGTTGCGGAGGAAGAACGTCATCTCTTTCGAGGTTTCACTCGTCCGGGACATTCGGGACCGCGAGTTCAAGATTTTCTCCGACGCGGGCCGTGTGATGAGGCCGCTGTTCACCGTAGAACAGGAGAAGAACGGAGAGAGCGGCGCAGAGATGGGCCAGCTCATTCTCAATAAGGACCACATTACGAGATTGGAGGCGGACAAGGAGTTGGGCAAGTATCACCCCGACTACTGGGGCTGGCAGGGCTTGTTGAAGTCGGGCGCCATCGAGTACCTCGATGCCGAAGAAGAGGAGACGGTCATGAT

Morphology On PDA at 25°C after 5 days, mycelium creamy white to dingy white, velutinous to woolly, growing on and into the media. Reverse tan to mustard yellow. Hyphae hyaline, guttulate. Spores hyaline, globose to subglobose, thick walled, smooth to faintly textured, 12.5-19 X 11.5-17.5 µm.
Name of Depositor M Brodhagen
Chain of Custody ATCC <-- M Brodhagen
Isolation Soil-buried compostable plastic ‘BioAgri’, Lubbock, TX.
Cross References

Nucleotide (GenBank) : KF597167 18S ribosomal RNA gene, partial sequence

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation