Unidentified Pleosporinae (ATCC® MYA-4960)

Strain Designations: BDM-UU  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations BDM-UU
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments Utilizes polylactic acid as a sole carbon source
Minimally alters chain length of polymers
Morphology On PDA at 25°C after 7 days, mycelium white becoming olive to charcoal gray, densely velutinous. Reverse creamy white to tan. Hyphae hyaline and dematiaceous, guttulate.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACATTCAGTAGCCTAGCTACTTGTTTATACCCTTGTTTTTTGCGTACCAATTGTTTCCTCGGCGGGCTTGCTCGCCGGCTGGACAAAACTATAACCTTTTTAAATCTTCAATCAGCGTCTGAATTATTTATAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTTTTGTCTTTTTCTTTAGTGATGAGACTCGCCTCAAAGTCATTGGCAGCCAGTGTTTTTGGTAGTAAGCGCAGCACATTTTGCGTCTTAGTCCCTAGACAGTGGCACCCATAAAGCCTCTTTTTCACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCTGGACTTTTGTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGG

Morphology On PDA at 25°C after 7 days, mycelium white becoming olive to charcoal gray, densely velutinous. Reverse creamy white to tan. Hyphae hyaline and dematiaceous, guttulate.
Name of Depositor M Brodhagen
Chain of Custody ATCC <-- M Brodhagen
Isolation Soil-buried compostable plastic (polyac tic acid), Mt. Vernon, WA
Cross References

Nucleotide (GenBank) : KF597177 18S ribosomal RNA gene, partial sequence

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation