Unidentified Pleosporinae (ATCC® MYA-4960)

Strain Designations: BDM-UU  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations BDM-UU
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments Utilizes polylactic acid as a sole carbon source
Minimally alters chain length of polymers
Morphology On PDA at 25°C after 7 days, mycelium white becoming olive to charcoal gray, densely velutinous. Reverse creamy white to tan. Hyphae hyaline and dematiaceous, guttulate.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACATTCAGTAGCCTAGCTACTTGTTTATACCCTTGTTTTTTGCGTACCAATTGTTTCCTCGGCGGGCTTGCTCGCCGGCTGGACAAAACTATAACCTTTTTAAATCTTCAATCAGCGTCTGAATTATTTATAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTTTTGTCTTTTTCTTTAGTGATGAGACTCGCCTCAAAGTCATTGGCAGCCAGTGTTTTTGGTAGTAAGCGCAGCACATTTTGCGTCTTAGTCCCTAGACAGTGGCACCCATAAAGCCTCTTTTTCACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCTGGACTTTTGTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGG

Morphology On PDA at 25°C after 7 days, mycelium white becoming olive to charcoal gray, densely velutinous. Reverse creamy white to tan. Hyphae hyaline and dematiaceous, guttulate.
Name of Depositor M Brodhagen
Chain of Custody ATCC <-- M Brodhagen
Isolation Soil-buried compostable plastic (polyac tic acid), Mt. Vernon, WA
Cross References

Nucleotide (GenBank) : KF597177 18S ribosomal RNA gene, partial sequence

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation