Halophytophthora fluviatilis Yang et Hong (ATCC® MYA-4961)

Strain Designations: 57A9  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Halophytophthora fluviatilis
Strain Designations 57A9
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments Pre-culturing in broth may increase the viability from frozen.
Morphology After 6 days on V8 Rye medium at 25°C, colonies are white, displaying rosette pattern. Hyphae hyaline, guttulate. Sporangia and oogonia not observed.
Medium ATCC® Medium 343: V8 juice agar
ATCC® Medium 1970: V8 rye agar
Growth Conditions Temperature: 20°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CCTAAAACTTTCCACGTGAACCGTTCGGATTGCCCTCGGGCATGACGTGGGGCTTCCCTGCTGCTTGCGCGCGTGCGTGCGCCTCCTTTTTGGGGGCGCGTGCGTGTGTGTGTGCGGGTCGAGGCCCCGTCTGGGTGATGCTGTGCCGTGTGCTGCGCTTGCTTTATTGTGGGTGCGGTGCGCTTGGCTTGGCGTTGCCTGGCGCCTTTTCTTTTGAAACCCTTACGTAATGACTGAGTATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGGACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGTCTGTATCAGTGTCCGTAAAGCACTCTTGCCTCTCTTCCTTCCGTGTAGTCGGTGGCGGGGACGGCAGACGTGAAGTGTCTTGCTGCGGCTTTTGGCTGCGGCAAGTCCTTTGAAACTTTACTTTTCTCTCTCTTTGCCGAAAGCGAGCTGGAAGTGTGACTGTGGCGGCTGCCTGTGTGGTGCTGCTGGGCGACTATTCCTGCGAGGGCGTTTCGGAGAGGGCTTGTTGATTCGCGGTATGTTAGGCTTCGGCCGGACAATGCGCTTATTGGCGGGCTCCTTTCTGCTCTTGCGGTTGAGTGGGCGTTCGGCGGCGCGTGCGCGTGGCTTGGCTGTTGAGTCTTGTACTTTCGGCGTTGAATCGCGAGTAGTGCGTCTGCGGAGGCTGTTTTGTGTATTCAGGACGGCTGTTGCGGGCGAGGGGGGACTGTCCATTTGGGAAATCTGTGCGTTTTGGCGCGTCTTCGGACGCGCTGGGGCGCATCTCAATTGGACCTGATATC


D1D2 region of the 28S ribosomal RNA gene

TTGGCGCGTCTTCGGACGCGCTGGGGCGCATCTCAATTGGACCTGATATCAGACAAGACTACCCGCTGAACTTAAGCATATTAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGTGCACGTTGTGCGCGGCGAATTGTAGTCTATAGATGCGTGATCAGCGTGGGCGCCCGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTTGTACCTGGGTGTCCTGCGCGTACGGTCCGTATTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGCGGCATATTTCACGTGCGAGTGCGTGCGTTTCGGCTTCGTGGCAGCGGTCATTTTTTGACTGCGCCCGTTGCTGTTTGTGCGTGCGCTTGCGTGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCCGTCGGGGAGGTAGGTCTTAAGCTCTGCTTTTGGCTATTATATCTCGGCGGTTGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGCGCGTGCGTGTCTCTGTGTGCGCGCTGTGCGGATAGCTTGCTATGCGCGTGGCGTTGCGTGCGGATTGATATGCGCTGCTGCTTGTTGCCGTTCGGGACTTTGACGAAATGGCGCGATCCGAC

Morphology After 6 days on V8 Rye medium at 25°C, colonies are white, displaying rosette pattern. Hyphae hyaline, guttulate. Sporangia and oogonia not observed.
Name of Depositor X Yang, C Hong
Chain of Custody ATCC <-- X Yang, C Hong
Isolation Stream water, Virginia, USA
References

Yang X, Hong C. Halophytophthora fluviatilis sp. nov. from freshwater in Virginia. FEMS Microbiol. Lett. 352: 230–237, 2014. PubMed: 24484074

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation