Halophytophthora fluviatilis Yang et Hong (ATCC® MYA-4961)

Strain Designations: 57A9  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Halophytophthora fluviatilis
Strain Designations 57A9
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments Pre-culturing in broth may increase the viability from frozen.
Morphology After 6 days on V8 Rye medium at 25°C, colonies are white, displaying rosette pattern. Hyphae hyaline, guttulate. Sporangia and oogonia not observed.
Medium ATCC® Medium 343: V8 juice agar
ATCC® Medium 1970: V8 rye agar
Growth Conditions Temperature: 20°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CCTAAAACTTTCCACGTGAACCGTTCGGATTGCCCTCGGGCATGACGTGGGGCTTCCCTGCTGCTTGCGCGCGTGCGTGCGCCTCCTTTTTGGGGGCGCGTGCGTGTGTGTGTGCGGGTCGAGGCCCCGTCTGGGTGATGCTGTGCCGTGTGCTGCGCTTGCTTTATTGTGGGTGCGGTGCGCTTGGCTTGGCGTTGCCTGGCGCCTTTTCTTTTGAAACCCTTACGTAATGACTGAGTATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGGACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGTCTGTATCAGTGTCCGTAAAGCACTCTTGCCTCTCTTCCTTCCGTGTAGTCGGTGGCGGGGACGGCAGACGTGAAGTGTCTTGCTGCGGCTTTTGGCTGCGGCAAGTCCTTTGAAACTTTACTTTTCTCTCTCTTTGCCGAAAGCGAGCTGGAAGTGTGACTGTGGCGGCTGCCTGTGTGGTGCTGCTGGGCGACTATTCCTGCGAGGGCGTTTCGGAGAGGGCTTGTTGATTCGCGGTATGTTAGGCTTCGGCCGGACAATGCGCTTATTGGCGGGCTCCTTTCTGCTCTTGCGGTTGAGTGGGCGTTCGGCGGCGCGTGCGCGTGGCTTGGCTGTTGAGTCTTGTACTTTCGGCGTTGAATCGCGAGTAGTGCGTCTGCGGAGGCTGTTTTGTGTATTCAGGACGGCTGTTGCGGGCGAGGGGGGACTGTCCATTTGGGAAATCTGTGCGTTTTGGCGCGTCTTCGGACGCGCTGGGGCGCATCTCAATTGGACCTGATATC


D1D2 region of the 28S ribosomal RNA gene

TTGGCGCGTCTTCGGACGCGCTGGGGCGCATCTCAATTGGACCTGATATCAGACAAGACTACCCGCTGAACTTAAGCATATTAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGTGCACGTTGTGCGCGGCGAATTGTAGTCTATAGATGCGTGATCAGCGTGGGCGCCCGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTTGTACCTGGGTGTCCTGCGCGTACGGTCCGTATTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGCGGCATATTTCACGTGCGAGTGCGTGCGTTTCGGCTTCGTGGCAGCGGTCATTTTTTGACTGCGCCCGTTGCTGTTTGTGCGTGCGCTTGCGTGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCCGTCGGGGAGGTAGGTCTTAAGCTCTGCTTTTGGCTATTATATCTCGGCGGTTGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGCGCGTGCGTGTCTCTGTGTGCGCGCTGTGCGGATAGCTTGCTATGCGCGTGGCGTTGCGTGCGGATTGATATGCGCTGCTGCTTGTTGCCGTTCGGGACTTTGACGAAATGGCGCGATCCGAC

Morphology After 6 days on V8 Rye medium at 25°C, colonies are white, displaying rosette pattern. Hyphae hyaline, guttulate. Sporangia and oogonia not observed.
Name of Depositor X Yang, C Hong
Chain of Custody ATCC <-- X Yang, C Hong
Isolation Stream water, Virginia, USA
References

Yang X, Hong C. Halophytophthora fluviatilis sp. nov. from freshwater in Virginia. FEMS Microbiol. Lett. 352: 230–237, 2014. PubMed: 24484074

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation