Aureobasidium pullulans var. melanigenum Hermanides-Nijhof (ATCC® 15233)

Strain Designations: QM 279c [CBS 249.65, F.A. 482, IMI 45533]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Pullularia pullulans (de Bary) Berkhout
Strain Designations QM 279c [CBS 249.65, F.A. 482, IMI 45533]
Application
Bacterial resistance testing adhesives
Fungus resistance testing adhesives
Fungus resistance testing polymers
Produces inulosucrase fructosyl transferase
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Taxonomy
Biosorption of copper by melanin
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAGTAAGGGTGCTCAGCGCCCGACCTCCAACCCTTTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGCTCGGTTCCGAGCCGCTGGGGATTCGTCCCAGGCGAGCGCCCGCCAGAGTTAAACCAAACTCTTGTTATTTAAACCGGTCGTCTGAGTTAAAATTTTGAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCTATGCTTGGTATTGGGTGCCGTCCTTAGTTGGGCGCGCCTTAAAGACCTCGGCGAGGCCACTCCGGCTTTAGGCGTAGTAGAATTTATTCGAACGTCTGTCAAAGGAGAGGAACTCTGCCGATTGAAACCTTTTATTTTTCTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTAGCCTTCGGGTTCGCATTGTAATTTGTAGAGGATGCTTTGGGTGAAACGCCAGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGAAATGTTAACCTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTTTAAACTGTTCGGCCGGTCTTCTGACCGGTTTACTCAGTTTGGACAGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGCATTGGGAATGTGGCCTCCACTTCGGTGGAGGTGTTATAGCCCAGTGTGTAATACGGCCAGCCGGGACTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC


beta-tubulin (TUB2) gene

TTTGTTGCTAACGTCTTTCTCCTATAGGTCCACCTCCAGACCGGCCAATGCGTATGCCTACCTGAAATGAGCTCCAATTGATTCGAGAACTACGCGTCTGACACTACAAACAGGGTAACCAAGTTGGTGCTGCCTTCTGGCAGACCATCTCTGGCGAGCACGGCCTTGACGGCGCTGGTGTGTACGTCGACTCCCTGCGCATCCTCACCCGTAGTGACAGCTCGCTGACTGCCTAACAGCTACAACGGTACCTCAGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGTCAGTCACCAACCATCGGCTCTTCGTTCACTATTTCGATGCTAATGCCCACCATAGGCCTCTGGTAACAAGTATGTCCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTCCGTGCTGGTCCCTTCGGTCAACTCTTCCGTCCCGACAACTTCGTCTTC

Name of Depositor BJ Wiley
Isolation
Painted wood, Costa Rica
Cross References

Nucleotide (GenBank) : KU933460 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU933461 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KU897018 beta-tubulin (TUB2) gene

References

Gadd GM, de Rome L. Biosorption of copper by fungal melanin. Appl. Microbiol. Biotechnol. 29: 610-617, 1988.

Heady RE. Process for the production of high fructose syrups and ethanol. US Patent 4,335,207 dated Jun 15 1982

Hermanides-Nijhof EJ. Aureobasidium and allied genera. Stud. Mycol. 15: 141-177, 1977.

ASTM International Standard Test Methods for Ability of Adhesive Films to Support or Resist the Growth of Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4300-01.

ASTM International Standard Test Methods for Resistance of Adhesive Preparations in Container to Attack by Bacteria, Yeast, and Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4783-01e1.

ASTM International Standard Practice for Determining Resistance of Synthetic Polymeric Materials to Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method G 0021-96 (Reapproved 2002).

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation