Cryptococcus liquefaciens (Saito & M. Ota) A. Fonseca, Boekhout & Fell (2009) (ATCC® 34140)

Strain Designations: CR-180  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Cryptococcus albidus (Saito) Skinner var. albidus
Strain Designations CR-180
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Comments
Identification
Morphology After 4 days on YM medium at 25°C, colonies white, smooth, glistening. Cells globose or ovoidal, single or with bud. Psuedohyphae absent.
Medium Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAATGATTAACTGTCTGTCGAGCTTGCTCACAGACTTATCATATCCATAACACCTGTGCACTTGTCGGATGGCTTAGTGAAGACCGCAAGGTTGGAACTATCCATCTACTTTACATAACAATTTAGTAACAAATGTAGTCTTATTATAACATAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCATGCCTGTTTGAGTGTCATGAAAACCCTCAACCTTAGATTGGTTAACACCTTTCTTTGGCTTGGATTTGGACGTTTGCCGATGATAAGTCGGCTCGTCTTAAAAGTAATAGCTGGATCTGTCTCGCGACATGGTTTGACTTGGCGTAATAAGTATTTCGCTAAGGACATCTTCGGATGGCCGCGTTGCAAGACTAAAGACCGCTTTCTAATCCATTGATCTTCGGATTAATATTCTTGACATCTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG


D1D2 region of the 26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTAGTAGCCTTCGGCTGCTCGAGTTGTAATCTAGAGAAGTGTTTTCCGTGCCGGCCCATGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACATGGACCCCCGGTGCTCTGTGATACACTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCATGCTCTTTGGTATTTATATCATTGAGTGGGGTCAACATCAGTTTTGATCGATGGATAAAGGCACTAGGAAGGTAGCACTCTCGGGTGAACTTATAGCCTGGCGTCATATACATTGATTGGGACTGAGGAACGCAGCATGCCTTTATGGCCGGGATTCGTCCACGTACATGCT

Morphology After 4 days on YM medium at 25°C, colonies white, smooth, glistening. Cells globose or ovoidal, single or with bud. Psuedohyphae absent.
Name of Depositor GD Roberts
Isolation
Clinical specimen, Minnesota
References

Roberts GD, et al. Evaluation of the API 20 c microtube system for the identification of clinically important yeasts. J. Clin. Microbiol. 3: 302-305, 1976. PubMed: 1270593

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation