Saccharomyces kudriavzevii Naumov et al. (ATCC® 2601)

Strain Designations: [2601-U]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Saccharomyces cerevisiae
Strain Designations [2601-U]
Application
Assay of amphotericin B fungizone
Assay of nystatin fungicidin
Pharmaceutical and Personal Care
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Preceptrol® yes
Comments No vitamin requirement

Reference strain for assays of amphotericin B fungizone and nystatin fungicidin designated by FDA. RefU.S. Pharmacopeia General Chapters; <81> Antibiotics-Microbial Assays. Rockville, MD: U.S. Pharmacopeia; USP USP34-NF29, 2011

The strain used to be classified as Saccharomyces cerevisiae based on traditional taxonomic characterizations, but a recent molecular authentication convincingly identified it as Saccharomyces kudriavzevii, not S. cerevisiae. The taxonomic update of this strain will not affect its application in antifungal drug testing assays and many other usages. RefSuh SO, et al. Update of USP drug testing reference strain ATCC® 2601™. Pharma. Microbiol. Forum Newslett. 19: 4-11, 2013.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 1245: YEPD
Growth Conditions
Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence;

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAAATTTAATAATTTTGAAAATGGATTTGTTTGTTTTGGCAAGAGCGTGAGAGCTTTTACTGGGCAAGTAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGCAAGTTTCTTTCTTGCTATTCCAAACAGTGAGAGATTTCTCTGTTTTTGTTATAGGACAATCAAAACCGTTTCAATACAACACACTGTGGAGTTTTTATATCTTTGCAACTTTTTCTTTGGGCTGTCGAGCAATCGGAGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTGTACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATATTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGAACCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCTCTGCTCCTTGTGGGTGGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCGTAGGAATGTAACTTGCTTCGGGAAGTATTATAGCCTGCGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC

Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- FW Tanner <-- CBS 679 (Zygosaccharomyces priorianus) <-- A Guilliermond
Isolation Not available
Cross References

Nucleotide (GenBank) : KC881068 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KC881065 D1/D2 region of 26S rRNA gene

Nucleotide (GenBank) : KC881095 RNA polymerase II largest subunit (RPB1) gene

Nucleotide (GenBank) : KC881092 polymerase II second largest subunit (RPB2) gene

Nucleotide (GenBank) : KC881097 translation elongation factor 1-alpha gene

Nucleotide (GenBank) : KC881100 mitochondrial small subunit ribosomal RNA gene

References

Suh SO, et al. Update of USP drug testing reference strain ATCC® 2601™. Pharma. Microbiol. Forum Newslett. 19: 4-11, 2013.

McGinnis MR. Laboratory handbook of medical mycology. New York: Academic Press; 1980.

U.S. Pharmacopeia General Chapters; <81> Antibiotics-Microbial Assays. Rockville, MD: U.S. Pharmacopeia; USP USP34-NF29, 2011

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation