Zygosaccharomyces parabailii Suh et al. (ATCC® MYA-4549)

Strain Designations: VITEK 301705 [MUCL 51627]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Zygosaccharomyces bailii (Lindner) Guilliermond
Strain Designations VITEK 301705 [MUCL 51627]
Application
quality control strain
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Comments
Quality control strain for VITEK2 Yeast Identification Card.
The strain differs from the type strain of Z. bailii at 4 nucleotide positions within the D1D2 region of LSU rDNA, and at 38 nucleotide positions in the ITS region.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
LSU rDNA of MYA-4549

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGTAGAAGGCGACTCTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAAAATCCCGTATGGCGAGGATCCCAGTTCTTTGTAGAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCTCGCCTCTCGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCCCTGGGAATGTAGCTCTACCACTTCGTGGCGGACGAACTTATAGTCCAGGGGAATACTGCCAGCTGGGACTGAGGAATGCGACTTTTTTAGTCAAGGATGCTGGCATAATGGTTATATGCCGC


ITS of MYA-4549

TTTCCGTAGGTGAACCTGCGGAAGGATCATTATAGAAAAATTTCTGATTGACGAGTCTGGAGCAGTTGTGTTCTTTCTGTTTTTTTTAAGGCCTGCGCTTAATTGCGCGGTCTAGAGCGGAGGGAGTTAAGCATAGTTGCTTTGGCTTTCAATTTACACACAGTGGAGTTTCTACTTTTTTTATTCTTCTTTGGGAGGATGGGTTCGTCCCGCTTCCAGAGGTAAACACAAACAATTTTTTTTATTTTATTTTATTTTATTATTATAATAATAATAATACAGTCAAAACGAATACTAAAACAAAAAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCGTGTTTGGTAGTGAGTGATACTCTGTTTTATTATTTGGGTTAACTTGAAATTGCAAGCCTTTTGGGGACGCGTGTGGGTGAGTTTTAGGCGGAAACGTCTTGCTCTCCTCTTTCCTAACCAAATGTCGTATTAGGTTTTACCGACTCCGACAGACGGGACTAGGAGATTGGGTGAGTGATAGCAATATCGAGCTCTGCCTAATTTTTTTTTTGCGCGCCTTGGGCAAACAATACTCTCAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGC

Name of Depositor bioMerieux, Inc.
Special Collection ATCC
Chain of Custody
ATCC <-- bioMerieux, Inc.
Cross References

Nucleotide (GenBank) : KC678106 RNA polymerase II largest subunit (RPB1) gene

Nucleotide (GenBank) : KC678081 polymerase II second largest subunit (RPB2) gene

Nucleotide (GenBank) : FJ914902 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ914883 ITS including 5.8S rRNA gene

References

VITEK 2 YST Comprehensive QC Set. bioMerieux.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation