pDEST34y
SB-1002 ™
pDEST34y is a Saccharomyces cerevisiae/Escherichia coli shuttle vector in the ATCC® Synthetic Biology Yeast Tool Kit. It contains two Gateway® recombination att sites (attR2 and attR4) for the assembly of a promoter and a gene via the Gateway® LR reaction (Gateway® Technology User Manual). For the detail Gateway® reaction, please refer to the manufacturer’s instructions. An ADH1 transcriptional terminator is located downstream of attR2. The transcription unit (TU), consisting of a promoter, a gene, and the terminator, can be released from the vector by a rare-cut restriction enzyme, I-SceI. Two 45 bp unique nucleotide sequences (UNS-3:GGTCTAATACCCAATCTCTCGTCTTATCCAGATGTTTTATACGCC and UNS-4: GGTGAATTCCCTTATGTGAGTGTAAAAGGCAGGCGAGTTTGTCCC) in the vector flanking the TU determine the TU’s position for building multiple transcription units (detail information is described in the ATCC® Synthetic Biology Solutions User Guide).