pCarrier 7 (426)
SB-1024 ™
pCarrier 7 (426) is a high-copy (2 µ) derivative of the yeast pRS426 vector (Christianson TW, et al. Gene 110(1): 119-122, 1992. Two unique 45 base-pair sequences (UNS-1: GGTTTACCGAGCTCTTATTGGTTTTCAAACTTCATTGACTGTGCC and UNS-X: GGTTAGGCGACTGTTATAACTTACCTCTGTAATACTAGTGATACC) in the vector allow for the assembly of multiple transcription units. (Detailed information is described in the ATCC® Synthetic Biology Solutions User Guide).