To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X
Search

Quantitative Synthetic Middle East respiratory syndrome coronavirus (MERS-CoV) RNA (ATCC® VR-3248SD™)

Product Format: frozen
Specification range: 1 x 105 to 1 x 106 copies/µL
100 µL per vial with Biomatrica RNAstable

Permits and Restrictions

View Permits

Agent Quantitative Synthetic Middle East respiratory syndrome coronavirus (MERS-CoV) RNA
Applications ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day-to-day test variation and lot-to-lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine viral load and for other molecular biology applications.
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format frozen
Specification range: 1 x 105 to 1 x 106 copies/µL
100 µL per vial with Biomatrica RNAstable
Storage Conditions -70°C or colder
Intended Use The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent.
Biomatrica Logo
Comments Manufactured under ISO 13485 guidance

Preparation includes fragments from the ORF1ab, ORF5, upper envelope (upE), ORF8b, nucleocapsid (N) protein gene, and 3' UTR regions

The following primers and probe can be used with this nucleic acid preparation RefCorman VM, et al. Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction. Euro Surveill 17(39): pii=20285, 2012.:
Forward primer: GCAACGCGCGATTCAGTT
Reverse primer: GCCTCTACACGGGACCCATA
Probe: CTCTTCACATAATCGCCCCGAGCTCG
Name of Depositor ATCC
Special Collection RNA
References

Corman VM, et al. Assays for laboratory confirmation of novel human coronavirus (hCoV-EMC) infections. Euro Surveill 17(49): pii=20334, 2012.

Corman VM, et al. Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction. Euro Surveill 17(39): pii=20285, 2012.

Corman VM, et al. Performance and clinical validation of the RealStar® MERS-CoV Kit for detection of Middle East respiratory syndrome coronavirus RNA. J. Clin. Virol. 60(2): 168-171, 2014. PubMed: 24726679

Lu X, et al. Real-time reverse transcription-PCR assay panel for Middle East respiratory syndrome coronavirus. J. Clin. Microbiol. 52(1): 67-75, 2013. PubMed: 24153118

World Health Organization. Laboratory Testing for Middle East Respiratory Syndrome Coronavirus - Interim Guidance (Revised). WHO/MERS/LAB/15.1, June 2015.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • This item is listed on the Commerce Control List of the U.S. Department of Commerce and is distributed only within the 50 United States. Distribution requires completion of a Customer Acceptance of Responsibility (CAR) for Commerce Control List (CCL) Biologicals form.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS
FAQs
  1. Test primers and probe for MERS-CoV synthetic RNA VR-3248SD

    ATCC used the following primers and probe to obtain a positive PCR product from this RNA:


    Date Updated: 11/16/2015