Gibberella fujikuroi (Sawada) Wollenweber (ATCC® 12616)

Alternate State: Fusarium moniliforme Sheldon, anamorph  /  Strain Designations: IMI 58290 [917, CBS 183.29, DSM 893]  /  Product Format: frozen

Strain Designations IMI 58290 [917, CBS 183.29, DSM 893]
Alternate State Fusarium moniliforme Sheldon, anamorph
Application
Produces gibberellic acid GA3, gibberellin A3
Produces gibberellins
Transformation of ent-15beta-hydroxy-kaur-16-ene derivatives
Transformation of ent-15beta,16beta-epoxy-kaurane derivatives
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Nonsporulating
Regulation of secondary biosynthesis
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGCCGGCCCCGAAATCTAGTGGCGGTCTCGCTGCAGCTTCCATTGCGTAGTAGTAAAACCCTCGCAACTGGTACGCGGCGCGGCCAAGCCGTTAAACCCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCGGGCCCGAGTTGTAATTTGTAGAGGATACTTTTGATGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCAAATCTCTGTAAAGTTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGGGCTTGGTTAATCATCTGGGGTTCTCCCCAGTGCACTTTTCCAGTCCAGGCCAGCATCAGTTTTCCCCGGGGGATAAAGACTTCGGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCCGTTGTGTAATACCCTGGGGGGGACTGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAACGA

Name of Depositor IMI
Chain of Custody
ATCC <-- IMI <-- P.W. Brian 917
Isolation
Rice culm, Oryza sativa, Japan
References

Munoz GA, Agosin E. Glutamine involvement in nitrogen control of gibberellic acid production in Gibberella fujikuroi. Appl. Environ. Microbiol. 59: 4317-4322, 1993.

Fraga BM, et al. Biotransformation of two ent-15þ-hydroxy-kaur-16-ene derivatives by Gibberella fujijuroi. Phytochemistry 31: 3845-3849, 1992.

Saucedo JE, et al. Continuous production of gibberellic acid in a fixed-bed reactor by immobilized mycelia of Gibberella fujikuroi in calcium alginate beads. Appl. Microbiol. Biotechnol. 30: 226-233, 1989.

Harris GM. Protoplasts from Gibberella fujikuroi. Phytopathology 72: 1403-1407, 1982.

Bu'lock JD, et al. Regulation of secondary biosynthesis i Gibberella fujikuroi. Trans. Br. Mycol. Soc. 62: 377-389, 1974.

Darken MA, et al. Production of gibberellic acid by fermentation. Appl. Microbiol. 7: 301-303, 1959.