Gibberella fujikuroi (Sawada) Wollenweber (ATCC® 12616)

Alternate State: Fusarium moniliforme Sheldon, anamorph  /  Strain Designations: IMI 58290 [917, CBS 183.29, DSM 893]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations IMI 58290 [917, CBS 183.29, DSM 893]
Alternate State Fusarium moniliforme Sheldon, anamorph
Application
Produces gibberellic acid GA3, gibberellin A3
Produces gibberellins
Transformation of ent-15beta-hydroxy-kaur-16-ene derivatives
Transformation of ent-15beta,16beta-epoxy-kaurane derivatives
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Nonsporulating
Regulation of secondary biosynthesis
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGCCGGCCCCGAAATCTAGTGGCGGTCTCGCTGCAGCTTCCATTGCGTAGTAGTAAAACCCTCGCAACTGGTACGCGGCGCGGCCAAGCCGTTAAACCCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCGGGCCCGAGTTGTAATTTGTAGAGGATACTTTTGATGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCAAATCTCTGTAAAGTTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGGGCTTGGTTAATCATCTGGGGTTCTCCCCAGTGCACTTTTCCAGTCCAGGCCAGCATCAGTTTTCCCCGGGGGATAAAGACTTCGGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCCGTTGTGTAATACCCTGGGGGGGACTGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAACGA

Name of Depositor IMI
Chain of Custody
ATCC <-- IMI <-- P.W. Brian 917
Isolation
Rice culm, Oryza sativa, Japan
References

Munoz GA, Agosin E. Glutamine involvement in nitrogen control of gibberellic acid production in Gibberella fujikuroi. Appl. Environ. Microbiol. 59: 4317-4322, 1993.

Fraga BM, et al. Biotransformation of two ent-15þ-hydroxy-kaur-16-ene derivatives by Gibberella fujijuroi. Phytochemistry 31: 3845-3849, 1992.

Saucedo JE, et al. Continuous production of gibberellic acid in a fixed-bed reactor by immobilized mycelia of Gibberella fujikuroi in calcium alginate beads. Appl. Microbiol. Biotechnol. 30: 226-233, 1989.

Harris GM. Protoplasts from Gibberella fujikuroi. Phytopathology 72: 1403-1407, 1982.

Bu'lock JD, et al. Regulation of secondary biosynthesis i Gibberella fujikuroi. Trans. Br. Mycol. Soc. 62: 377-389, 1974.

Darken MA, et al. Production of gibberellic acid by fermentation. Appl. Microbiol. 7: 301-303, 1959.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation