Allomyces macrogynus (Emerson) Emerson et Wilson (ATCC® 38327_TT)

Strain Designations: Burma 3-35  /  Product Format: test tube

Permits and Restrictions

View Permits

Strain Designations Burma 3-35
Application
classroom demonstration
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format test tube
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Motility
Male gamete messenger RNA
Autotetraploid
Genome sequencing strain (Broad Institute, USA).
Morphology

After 2 weeks advancing zone appressed, mycelium white with older growth turning butyrous and orange as zoosporangia are formed.

Medium ATCC® Medium 350: Emerson YpSs agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene

CGAGTAATGGCGAATGAAACGGGAAAAGCCCAAATTTGAAATCTCCTAGCTTTTATCGCTAGGCGAGTTGTAATTTGTAGAAGGTCTTCATCTGAACTGTGTTTGCTAAAGTCCATTGGAAAATGGCGGGCCTTTATGGTCCTCAAGTCGTAGAGGGTGACAACCCCGTTCTTGGCATTCTACTAGTTCTTTTGTATGATTCCTTCAAAGAGTCGGATTGTTTGGGAATGCAATCCAAAACGGGTGGTAAATTCCATCCAAGGCTAAATATTAGCAAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTCTGAAGAGAGAGTTCAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAACGATTGTTGCTTTTGGTTTCGGCCTTGAGCGAGTCAGCAGCAGTTTTAAACGGTAAAGAAGTGCTTGTGGAAGGTAGTTTTCTTTGGAAAATGTTATAGCCATAAGTAACTGTGCCGGTTAGGACTGAGGATCGCTTTTAAGTGTCTTGTCGAGGAATTTTGGGCCGTTAGCGCCAAGGCCTTGGGCTTGCTCAAGACTTGGTGTTAACTGTTCAGGACGACCAAACACAAGGCCTTAAAAT

Morphology

After 2 weeks advancing zone appressed, mycelium white with older growth turning butyrous and orange as zoosporangia are formed.

Name of Depositor J Pommerville
Chain of Custody
ATCC <-- J Pommerville <-- R. Emerson
Isolation
Pond soil
Cross References

Nucleotide (GenBank) : JX094785 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : ACDU00000000 Allomyces macrogynus ATCC 38327, whole genome shotgun sequencing project

References

Morrison PJAllomyces macrogynusIn: Morrison PJLower fungi in the laboratoryAthens, GAUniv. Georgiapp. 45-46, 1978

Eisenberg A, Mascarenhas JP. Male gamete messenger RNAs in Allomyces. Exp. Mycol. 5: 173-177, 1981.

Pommerville J. Analysis of gamete and zygote motility in Allomyces. Exp. Cell Res. 113: 161-172, 1978. PubMed: 565293

. . Protoplasma 100: 323-343, 1979.

Aronson JM, Sandstedt V. Allomyces macrogynusIn: Aronson JM, Sandstedt V. Lower fungi in the laboratory. Athens, GA Univ. Georgia. pp. 51-52, 1978.

Barstow WE. Allomyces macrogynusIn: Barstow WE. Lower fungi in the laboratory, Athens, GA Univ. Georgia. pp. 49-50, 1978.

Pommerville J. Allomyces macrogynus--gametes and fertilizationIn: Pommerville J. Lower fungi in the laboratory. Athens, GA Univ. Georgia. pp. 47-48, 1978.

Spatafora JW, et al. A phylum-level phylogenetic classification of zygomycete fungi based on genome-scale data. Mycologia 108:1028-1046, 2016. PubMed: 27738200

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation